WormBase Tree Display for Variation: WBVar00145618
expand all nodes | collapse all nodes | view schema
| WBVar00145618 | Evidence | Paper_evidence | WBPaper00010874 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | gk211 | |||||
| Other_name | B0412.1a.1:c.239_430-103del | ||||||
| B0412.1b.1:c.-71_121-103del | |||||||
| HGVSg | CHROMOSOME_III:g.818528_818875del | ||||||
| Sequence_details | SMap | S_parent | Sequence | B0412 | |||
| Flanking_sequences | ctggctcttcatcttcactgaatggttctt | atctcttttttaaagaaaataaaaatctct | |||||
| Mapping_target | B0412 | ||||||
| Type_of_mutation | Deletion | ||||||
| PCR_product | gk211_external | ||||||
| gk211_internal | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00035733 | ||||||
| Laboratory | VC | ||||||
| Person | WBPerson427 | ||||||
| KO_consortium_allele | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00000895 | |||||
| Transcript | B0412.1b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | B0412.1b.1:c.-71_121-103del | ||||||
| cDNA_position | 282-? | ||||||
| Intron_number | 3-4/10 | ||||||
| Exon_number | 2-4/11 | ||||||
| B0412.1a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | B0412.1a.1:c.239_430-103del | ||||||
| cDNA_position | 365-? | ||||||
| CDS_position | 239-? | ||||||
| Protein_position | 80-? | ||||||
| Intron_number | 3-4/10 | ||||||
| Exon_number | 3-4/11 | ||||||
| Isolation | Mutagen | UV/TMP | |||||
| Description | Phenotype_not_observed | WBPhenotype:0000095 | Paper_evidence | WBPaper00033137 | |||
| Curator_confirmed | WBPerson557 | ||||||
| Remark | These animals have all six coelomocytes. The adult C. elegans hermaphrodite has six coelomocytes, four generated during embryogenesis and two derived from the M mesoblast. | Paper_evidence | WBPaper00033137 | ||||
| Curator_confirmed | WBPerson557 | ||||||
| WBPhenotype:0000618 | Paper_evidence | WBPaper00033137 | |||||
| Curator_confirmed | WBPerson557 | ||||||
| Remark | These animals have all six coelomocytes. The adult C. elegans hermaphrodite has six coelomocytes, four generated during embryogenesis and two derived from the M mesoblast. | Paper_evidence | WBPaper00033137 | ||||
| Curator_confirmed | WBPerson557 | ||||||
| WBPhenotype:0001912 | Paper_evidence | WBPaper00033137 | |||||
| Curator_confirmed | WBPerson557 | ||||||
| Remark | These animals have all six coelomocytes. The adult C. elegans hermaphrodite has six coelomocytes, four generated during embryogenesis and two derived from the M mesoblast. | Paper_evidence | WBPaper00033137 | ||||
| Curator_confirmed | WBPerson557 | ||||||
| Reference | WBPaper00010874 | ||||||
| WBPaper00033137 | |||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
| Method | KO_consortium_allele |
