WormBase Tree Display for Variation: WBVar00145618
expand all nodes | collapse all nodes | view schema
WBVar00145618 | Evidence | Paper_evidence | WBPaper00010874 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | gk211 | |||||
Other_name | B0412.1a.1:c.239_430-103del | ||||||
B0412.1b.1:c.-71_121-103del | |||||||
HGVSg | CHROMOSOME_III:g.818528_818875del | ||||||
Sequence_details | SMap | S_parent | Sequence | B0412 | |||
Flanking_sequences | ctggctcttcatcttcactgaatggttctt | atctcttttttaaagaaaataaaaatctct | |||||
Mapping_target | B0412 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product (2) | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00035733 | ||||||
Laboratory | VC | ||||||
Person | WBPerson427 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00000895 | |||||
Transcript | B0412.1b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | B0412.1b.1:c.-71_121-103del | ||||||
cDNA_position | 282-? | ||||||
Intron_number | 3-4/10 | ||||||
Exon_number | 2-4/11 | ||||||
B0412.1a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | B0412.1a.1:c.239_430-103del | ||||||
cDNA_position | 365-? | ||||||
CDS_position | 239-? | ||||||
Protein_position | 80-? | ||||||
Intron_number | 3-4/10 | ||||||
Exon_number | 3-4/11 | ||||||
Isolation | Mutagen | UV/TMP | |||||
Description | Phenotype_not_observed | WBPhenotype:0000095 | Paper_evidence | WBPaper00033137 | |||
Curator_confirmed | WBPerson557 | ||||||
Remark | These animals have all six coelomocytes. The adult C. elegans hermaphrodite has six coelomocytes, four generated during embryogenesis and two derived from the M mesoblast. | Paper_evidence | WBPaper00033137 | ||||
Curator_confirmed | WBPerson557 | ||||||
WBPhenotype:0000618 | Paper_evidence | WBPaper00033137 | |||||
Curator_confirmed | WBPerson557 | ||||||
Remark | These animals have all six coelomocytes. The adult C. elegans hermaphrodite has six coelomocytes, four generated during embryogenesis and two derived from the M mesoblast. | Paper_evidence | WBPaper00033137 | ||||
Curator_confirmed | WBPerson557 | ||||||
WBPhenotype:0001912 | Paper_evidence | WBPaper00033137 | |||||
Curator_confirmed | WBPerson557 | ||||||
Remark | These animals have all six coelomocytes. The adult C. elegans hermaphrodite has six coelomocytes, four generated during embryogenesis and two derived from the M mesoblast. | Paper_evidence | WBPaper00033137 | ||||
Curator_confirmed | WBPerson557 | ||||||
Reference | WBPaper00010874 | ||||||
WBPaper00033137 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |