WormBase Tree Display for Variation: WBVar00143963
expand all nodes | collapse all nodes | view schema
| WBVar00143963 | Name | Public_name | e1386 | |||||
|---|---|---|---|---|---|---|---|---|
| Other_name | W01G7.1.1:c.546-1G>A | |||||||
| W01G7.1.2:c.546-1G>A | ||||||||
| HGVSg | CHROMOSOME_II:g.14035814C>T | |||||||
| Sequence_details | SMap | S_parent | Sequence | W01G7 | ||||
| Flanking_sequences | agaccaacaaaacaaccaaagccatttcca | ggacatctccgatcgagttcacgttgtgca | ||||||
| Mapping_target | W01G7 | |||||||
| Type_of_mutation | Substitution | g | a | |||||
| SeqStatus | Sequenced | |||||||
| Variation_type | Allele | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Strain | WBStrain00004317 | |||||||
| WBStrain00026946 | ||||||||
| WBStrain00030737 | ||||||||
| Laboratory | CB | |||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00000901 | ||||||
| Transcript | W01G7.1.1 | VEP_consequence | splice_acceptor_variant | |||||
| VEP_impact | HIGH | |||||||
| HGVSc | W01G7.1.1:c.546-1G>A | |||||||
| Intron_number | 4/6 | |||||||
| W01G7.1.2 | VEP_consequence | splice_acceptor_variant | ||||||
| VEP_impact | HIGH | |||||||
| HGVSc | W01G7.1.2:c.546-1G>A | |||||||
| Intron_number | 5/7 | |||||||
| Interactor (59) | ||||||||
| Genetics | Interpolated_map_position | II | 22.3158 | |||||
| Mapping_data | In_2_point | 270 | ||||||
| 416 | ||||||||
| 417 | ||||||||
| Description | Phenotype (22) | |||||||
| Phenotype_not_observed | WBPhenotype:0001653 | Paper_evidence | WBPaper00026674 | |||||
| Curator_confirmed | WBPerson2987 | |||||||
| Remark | Table 3 | Paper_evidence | WBPaper00026674 | |||||
| Curator_confirmed | WBPerson2987 | |||||||
| Affected_by | Molecule | WBMol:00003022 | Paper_evidence | WBPaper00026674 | ||||
| Curator_confirmed | WBPerson2987 | |||||||
| WBPhenotype:0001690 | Paper_evidence | WBPaper00002589 | ||||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Animals were positive for mAb M37 at the L1 stage but not at any other stage, similar to N2 animals. | Paper_evidence | WBPaper00002589 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Penetrance | Low | Paper_evidence | WBPaper00002589 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Phenotype_assay | Temperature | 27.5 | Paper_evidence | WBPaper00002589 | ||||
| Curator_confirmed | WBPerson712 | |||||||
| WBPhenotype:0002535 | Paper_evidence | WBPaper00000932 | ||||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | FITC uptake is normal. | Paper_evidence | WBPaper00000932 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Reference (13) | ||||||||
| Method | Substitution_allele |
