WormBase Tree Display for Variation: WBVar00143963
expand all nodes | collapse all nodes | view schema
| WBVar00143963 | Name | Public_name | e1386 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Other_name | W01G7.1.1:c.546-1G>A | ||||||||
| W01G7.1.2:c.546-1G>A | |||||||||
| HGVSg | CHROMOSOME_II:g.14035814C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | W01G7 | |||||
| Flanking_sequences | agaccaacaaaacaaccaaagccatttcca | ggacatctccgatcgagttcacgttgtgca | |||||||
| Mapping_target | W01G7 | ||||||||
| Type_of_mutation | Substitution | g | a | ||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00004317 | ||||||||
| WBStrain00026946 | |||||||||
| WBStrain00030737 | |||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00000901 | |||||||
| Transcript | W01G7.1.1 | VEP_consequence | splice_acceptor_variant | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | W01G7.1.1:c.546-1G>A | ||||||||
| Intron_number | 4/6 | ||||||||
| W01G7.1.2 | VEP_consequence | splice_acceptor_variant | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | W01G7.1.2:c.546-1G>A | ||||||||
| Intron_number | 5/7 | ||||||||
| Interactor | WBInteraction000000783 | ||||||||
| WBInteraction000051122 | |||||||||
| WBInteraction000051123 | |||||||||
| WBInteraction000051124 | |||||||||
| WBInteraction000051125 | |||||||||
| WBInteraction000051126 | |||||||||
| WBInteraction000051127 | |||||||||
| WBInteraction000051128 | |||||||||
| WBInteraction000051129 | |||||||||
| WBInteraction000051130 | |||||||||
| WBInteraction000051131 | |||||||||
| WBInteraction000051132 | |||||||||
| WBInteraction000051133 | |||||||||
| WBInteraction000051134 | |||||||||
| WBInteraction000051135 | |||||||||
| WBInteraction000051136 | |||||||||
| WBInteraction000051137 | |||||||||
| WBInteraction000051138 | |||||||||
| WBInteraction000051139 | |||||||||
| WBInteraction000051140 | |||||||||
| WBInteraction000051141 | |||||||||
| WBInteraction000051142 | |||||||||
| WBInteraction000051143 | |||||||||
| WBInteraction000051144 | |||||||||
| WBInteraction000051145 | |||||||||
| WBInteraction000051146 | |||||||||
| WBInteraction000051147 | |||||||||
| WBInteraction000051148 | |||||||||
| WBInteraction000051149 | |||||||||
| WBInteraction000051150 | |||||||||
| WBInteraction000051151 | |||||||||
| WBInteraction000051153 | |||||||||
| WBInteraction000051154 | |||||||||
| WBInteraction000051155 | |||||||||
| WBInteraction000051156 | |||||||||
| WBInteraction000051157 | |||||||||
| WBInteraction000051158 | |||||||||
| WBInteraction000051159 | |||||||||
| WBInteraction000051160 | |||||||||
| WBInteraction000051161 | |||||||||
| WBInteraction000051162 | |||||||||
| WBInteraction000051163 | |||||||||
| WBInteraction000051164 | |||||||||
| WBInteraction000051165 | |||||||||
| WBInteraction000051166 | |||||||||
| WBInteraction000051167 | |||||||||
| WBInteraction000052358 | |||||||||
| WBInteraction000052366 | |||||||||
| WBInteraction000052368 | |||||||||
| WBInteraction000052445 | |||||||||
| WBInteraction000052448 | |||||||||
| WBInteraction000052450 | |||||||||
| WBInteraction000052452 | |||||||||
| WBInteraction000052454 | |||||||||
| WBInteraction000052456 | |||||||||
| WBInteraction000520184 | |||||||||
| WBInteraction000536043 | |||||||||
| WBInteraction000536047 | |||||||||
| WBInteraction000536051 | |||||||||
| Genetics | Interpolated_map_position | II | 22.3158 | ||||||
| Mapping_data | In_2_point | 270 | |||||||
| 416 | |||||||||
| 417 | |||||||||
| Description | Phenotype | WBPhenotype:0000013 | Paper_evidence | WBPaper00000316 | |||||
| WBPaper00000504 | |||||||||
| Person_evidence | WBPerson261 | ||||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | defective dauer formation | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Ease_of_scoring | ES1_Very_hard_to_score | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000542 | Paper_evidence | WBPaper00043908 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000637 | Paper_evidence | WBPaper00038374 | |||||||
| WBPaper00042548 | |||||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPerson237 | |||||||||
| Remark | "daf-2(e1370); daf-3(mgDf90) worms show significant enhancement of daf-2(e1370) dauer formation across several temperatures tested, whereas a daf-5 mutation or daf-5 RNAi results in reduced daf-2(e1370) dauer formation (Figure 4Ci, Figure 4Cii and Figure S11). In addition, daf-5(e1386); daf-2(e1370) worms fail to completely arrest at the restrictive temperature of 25C (data not shown)." | Paper_evidence | WBPaper00038374 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Figure 1, 2 and 3 | Paper_evidence | WBPaper00042548 | |||||||
| Curator_confirmed | WBPerson237 | ||||||||
| Phenotype_assay | Genotype | daf-2(e1370) | Paper_evidence | WBPaper00038374 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000660 | Paper_evidence | WBPaper00005511 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | daf-5 mutants do not aggregate and border on food | Paper_evidence | WBPaper00005511 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00005511 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00005511 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001005 | Paper_evidence | WBPaper00043908 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001171 | Paper_evidence | WBPaper00038374 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "In contrast, daf-5(e1386); daf-2(e1370) double mutants live much shorter than daf-2(e1370) worms (Figure 4A, Figure S13 and Table S1)." | Paper_evidence | WBPaper00038374 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | daf-2(e1370) | Paper_evidence | WBPaper00038374 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001183 | Paper_evidence | WBPaper00038374 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "We next tested the role of DAF-3 and DAF-5 on fat storage, dauer formation and stress resistance. Oil Red O staining for fat storage showed comparable levels between daf-2(e1370) and daf-2(e1370); daf-3(mgDf90) worms, but markedly lesser amounts of fat in daf-5(e1386); daf-2(e1370) worms (Figure 4B top and bottom panel and Figure S12)." | Paper_evidence | WBPaper00038374 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | daf-2(e1370) | Paper_evidence | WBPaper00038374 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001692 | Paper_evidence | WBPaper00002589 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals did not display the L2 M37 epitope to the same extent as wildtype when grown in the presence of pheromone, e.g. animals were ILD defective. | Paper_evidence | WBPaper00002589 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001716 | Paper_evidence | WBPaper00043908 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0002286 | Paper_evidence | WBPaper00043908 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0002290 | Paper_evidence | WBPaper00043908 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0002291 | Paper_evidence | WBPaper00043908 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0002299 | Paper_evidence | WBPaper00043908 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0002302 | Paper_evidence | WBPaper00043908 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0002309 | Paper_evidence | WBPaper00043908 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0002312 | Paper_evidence | WBPaper00043908 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0002319 | Paper_evidence | WBPaper00043908 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0002325 | Paper_evidence | WBPaper00043908 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0002328 | Paper_evidence | WBPaper00043908 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0002337 | Paper_evidence | WBPaper00043908 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0002346 | Paper_evidence | WBPaper00043908 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0004023 | Paper_evidence | WBPaper00043908 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_not_observed | WBPhenotype:0001653 | Paper_evidence | WBPaper00026674 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Table 3 | Paper_evidence | WBPaper00026674 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Affected_by | Molecule | WBMol:00003022 | Paper_evidence | WBPaper00026674 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001690 | Paper_evidence | WBPaper00002589 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals were positive for mAb M37 at the L1 stage but not at any other stage, similar to N2 animals. | Paper_evidence | WBPaper00002589 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Penetrance | Low | Paper_evidence | WBPaper00002589 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 27.5 | Paper_evidence | WBPaper00002589 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0002535 | Paper_evidence | WBPaper00000932 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | FITC uptake is normal. | Paper_evidence | WBPaper00000932 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00038374 | ||||||||
| WBPaper00043908 | |||||||||
| WBPaper00000504 | |||||||||
| WBPaper00000932 | |||||||||
| WBPaper00002589 | |||||||||
| WBPaper00021876 | |||||||||
| WBPaper00000316 | |||||||||
| WBPaper00015224 | |||||||||
| WBPaper00016006 | |||||||||
| WBPaper00026674 | |||||||||
| WBPaper00010064 | |||||||||
| WBPaper00005511 | |||||||||
| WBPaper00042548 | |||||||||
| Method | Substitution_allele |
