WormBase Tree Display for Variation: WBVar00143865
expand all nodes | collapse all nodes | view schema
WBVar00143865 | Evidence | Paper_evidence | WBPaper00006502 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1256 | |||||||
Other_name | ZK381.1a.1:c.71C>T | ||||||||
CE07625:p.Thr24Met | |||||||||
HGVSg | CHROMOSOME_IV:g.6977596C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZK381 | |||||
Flanking_sequences | aaattcctatagccagccagtggaaggcca | gtttcccgttgatctagagattgaaaaaaa | |||||||
Mapping_target | ZK381 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004278 | ||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001862 | |||||||
Transcript | ZK381.1a.1 (12) | ||||||||
Interactor | WBInteraction000558062 | ||||||||
WBInteraction000558063 | |||||||||
WBInteraction000558064 | |||||||||
Genetics | Interpolated_map_position | IV | 3.26859 | ||||||
Mapping_data | In_pos_neg_data | 5437 | |||||||
5438 | |||||||||
5439 | |||||||||
5440 | |||||||||
5441 | |||||||||
5442 | |||||||||
5443 | |||||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00000179 | |||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 70.9% eggs never hatch, yet are refractile; wild type animals produce 0.8% inviable zygotes. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
males sire inviable zygotes | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals have an average brood size of 4523 s.d. (9 broods counted), wild type has average brood size 33034 s.d. (8 broods counted). | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000179 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000351 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | many unhatched eggs (71%) | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000742 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | some reduction in autosomal recombination | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000863 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males exhibit 5.4% wild type fertility. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000179 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001175 | Paper_evidence | WBPaper00000179 | |||||||
WBPaper00048917 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson721 | |||||||||
Remark | Animals segregate 10.9% males compared to 0.3% segregated by wild type animals. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
stronger allele than e1147; 11% Him | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001499 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | probably generalized meiotic nondisjunction, effects on segregation of free duplications | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001583 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals segregate a small percentage (1.2%) of short animals shown to be 3X hermaphrodites (wild type segregates 0.04% 3X herm.). | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000179 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000517 | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals are indistinguishable from wild type in terms of behavior. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000520 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Both hermaphrodites and males are indistinguishable from wild type in terms of superficial anatomy. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001631 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The sex ratio of cross progeny sired by him males does not significantly differ from 1:1. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000179 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00015329 | ||||||||
WBPaper00014382 | |||||||||
WBPaper00000179 | |||||||||
WBPaper00011748 | |||||||||
WBPaper00011726 | |||||||||
WBPaper00023340 | |||||||||
WBPaper00048917 | |||||||||
Method | Substitution_allele |