WormBase Tree Display for Variation: WBVar00143773
expand all nodes | collapse all nodes | view schema
| WBVar00143773 | Evidence | Person_evidence | WBPerson384 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e1141 | |||||||
| Other_name | e1114 | Person_evidence | WBPerson384 | ||||||
| CE05795:p.Thr66Ile | |||||||||
| F32G8.6.1:c.197C>T | |||||||||
| HGVSg | CHROMOSOME_V:g.10565677C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F32G8 | |||||
| Flanking_sequences | caggagaagacatcaatcgtcagggacttctgaaaa | tccagaacgtgctgccaaagcaatgatggcattcac | |||||||
| Mapping_target | F32G8 | ||||||||
| Type_of_mutation | Substitution | c | t | ||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00004253 | ||||||||
| WBStrain00004816 | |||||||||
| WBStrain00027351 | |||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00000298 | |||||||
| Transcript | F32G8.6.1 (12) | ||||||||
| Interactor | WBInteraction000500584 | ||||||||
| WBInteraction000555810 | |||||||||
| Genetics | Interpolated_map_position | V | 2.59941 | ||||||
| Mapping_data | In_multi_point | 151 | |||||||
| 1529 | |||||||||
| 2269 | |||||||||
| In_pos_neg_data | 6765 | ||||||||
| 6766 | |||||||||
| 6767 | |||||||||
| 6769 | |||||||||
| 6771 | |||||||||
| Description | Phenotype (29) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000456 | Paper_evidence | WBPaper00000365 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000525 | Paper_evidence | WBPaper00001861 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001206 | Paper_evidence | WBPaper00001861 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Mutants defective in the synthesis and reception of nonessential excitatory neurotransmitters respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001780 | Paper_evidence | WBPaper00029060 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Mutants show normal butanone enhancement | Paper_evidence | WBPaper00029060 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00029060 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Preexposure to 1:10 dilution of butanone and food. Animals were then subjected to odorant chemotaxis assays and/or selection assays | Paper_evidence | WBPaper00029060 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference (17) | |||||||||
| Method | Substitution_allele |
