WormBase Tree Display for Variation: WBVar00143205
expand all nodes | collapse all nodes | view schema
| WBVar00143205 | Name | Public_name | e428 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Other_name | CE26205:p.Gln394Ter | ||||||||
| Y59A8B.1a.1:c.1180C>T | |||||||||
| HGVSg | CHROMOSOME_V:g.17945749G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | Y59A8B | |||||
| Flanking_sequences | acgtcatccacggactcactggagcatatg | agaggaagagaaagaagcaacaggagactg | |||||||
| Mapping_target | Y59A8B | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00006355 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain (18) | |||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00001080 | |||||||
| Transcript | Y59A8B.1a.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | Y59A8B.1a.1:c.1180C>T | ||||||||
| HGVSp | CE26205:p.Gln394Ter | ||||||||
| cDNA_position | 1345 | ||||||||
| CDS_position | 1180 | ||||||||
| Protein_position | 394 | ||||||||
| Exon_number | 7/13 | ||||||||
| Codon_change | Cag/Tag | ||||||||
| Amino_acid_change | Q/* | ||||||||
| Interactor | WBInteraction000052180 | ||||||||
| WBInteraction000052432 | |||||||||
| WBInteraction000501500 | |||||||||
| Genetics | Interpolated_map_position | V | 13.3373 | ||||||
| Mapping_data | In_2_point (11) | ||||||||
| In_multi_point (15) | |||||||||
| Description | Phenotype (14) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000065 | Paper_evidence | WBPaper00001077 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000520 | Paper_evidence | WBPaper00000666 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | XO males are morphologically indistinguishable from wild type males. | Paper_evidence | WBPaper00000666 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Recessive | Paper_evidence | WBPaper00000666 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000666 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000648 | Paper_evidence | WBPaper00000666 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | XO males are not mating deficient relative to wild type males in fertility measurements. | Paper_evidence | WBPaper00000666 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Recessive | Paper_evidence | WBPaper00000666 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000666 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference (13) | |||||||||
| Remark | The molecular changes given above for this allele were previously attributed to allele y428, owing to a published typo. | Person_evidence | WBPerson421 | ||||||
| Method | Substitution_allele |
