WormBase Tree Display for Variation: WBVar00143205
expand all nodes | collapse all nodes | view schema
WBVar00143205 | Name | Public_name | e428 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | CE26205:p.Gln394Ter | ||||||||
Y59A8B.1a.1:c.1180C>T | |||||||||
HGVSg | CHROMOSOME_V:g.17945749G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y59A8B | |||||
Flanking_sequences | acgtcatccacggactcactggagcatatg | agaggaagagaaagaagcaacaggagactg | |||||||
Mapping_target | Y59A8B | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00006355 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (18) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects (3) | |||||||||
Genetics | Interpolated_map_position | V | 13.3373 | ||||||
Mapping_data | In_2_point (11) | ||||||||
In_multi_point (15) | |||||||||
Description | Phenotype (14) | ||||||||
Phenotype_not_observed | WBPhenotype:0000065 | Paper_evidence | WBPaper00001077 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000520 | Paper_evidence | WBPaper00000666 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | XO males are morphologically indistinguishable from wild type males. | Paper_evidence | WBPaper00000666 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000666 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000666 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000648 | Paper_evidence | WBPaper00000666 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | XO males are not mating deficient relative to wild type males in fertility measurements. | Paper_evidence | WBPaper00000666 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000666 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000666 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (13) | |||||||||
Remark | The molecular changes given above for this allele were previously attributed to allele y428, owing to a published typo. | Person_evidence | WBPerson421 | ||||||
Method | Substitution_allele |