WormBase Tree Display for Variation: WBVar00143102
expand all nodes | collapse all nodes | view schema
WBVar00143102 | Evidence | Paper_evidence | WBPaper00002911 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e307 | ||||||
Other_name | T20G5.6.1:c.1280-1G>A | |||||||
HGVSg | CHROMOSOME_III:g.10184104C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | T20G5 | ||||
Flanking_sequences | ggatttttctgccgcaaatttatgtttcca | gaacaatgttatcatttatctggccggcact | ||||||
Mapping_target | T20G5 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002911 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004145 | |||||||
WBStrain00030694 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006783 | ||||||
Transcript | T20G5.6.1 | VEP_consequence | splice_acceptor_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | T20G5.6.1:c.1280-1G>A | |||||||
Intron_number | 5/7 | |||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | III | 2.00018 | |||||
Mapping_data (3) | ||||||||
Description | Phenotype (15) | |||||||
Phenotype_not_observed | WBPhenotype:0000306 | Paper_evidence | WBPaper00032190 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Expression of ChR2-YFP in GABAergic neurons was not affected. | Paper_evidence | WBPaper00032190 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | zxIs3 | Paper_evidence | WBPaper00032190 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000567 | Paper_evidence | WBPaper00032190 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Dorsal coiling was not triggered in animals treated to photostimulation of ChR2-YFP in cholinergic neurons. | Paper_evidence | WBPaper00032190 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | ChR2-YFP was activated in animals swimming in liquid, or on solid substrates, by applying 450-490 nm light. The chromophore essential fro ChR2 function was supplied by growing transgenic animals on medium containing all-trans retinal. | Paper_evidence | WBPaper00032190 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | zxIs6 | Paper_evidence | WBPaper00032190 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table 1 | Paper_evidence | WBPaper00040284 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00002911 | |||||||
WBPaper00040284 | ||||||||
WBPaper00031872 | ||||||||
WBPaper00000031 | ||||||||
WBPaper00032190 | ||||||||
WBPaper00016473 | ||||||||
WBPaper00056338 | ||||||||
Method | Substitution_allele |