WormBase Tree Display for Variation: WBVar00091497
expand all nodes | collapse all nodes | view schema
WBVar00091497 | Evidence | Paper_evidence | WBPaper00004723 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ok186 | ||||||
Other_name | F33D4.1a.1:c.564+20_1533del | |||||||
F33D4.1b.1:c.561+23_1530del | ||||||||
HGVSg | CHROMOSOME_IV:g.7712653_7714019del | |||||||
Sequence_details | SMap | S_parent | Sequence | F33D4 | ||||
Flanking_sequences | caacagctgtggttagtagagtttaaaata | ggtaaatcacgtgctgacattgcatacagt | ||||||
Mapping_target | F33D4 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok186_external | |||||||
ok186_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00000059 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00171604 | ||||||
WBGene00003607 | ||||||||
Transcript | F33D4.10 | |||||||
F33D4.1b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F33D4.1b.1:c.561+23_1530del | |||||||
cDNA_position | ?-1691 | |||||||
CDS_position | ?-1530 | |||||||
Protein_position | ?-510 | |||||||
Intron_number | 5-9/10 | |||||||
Exon_number | 6-10/11 | |||||||
F33D4.1a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F33D4.1a.1:c.564+20_1533del | |||||||
cDNA_position | ?-1699 | |||||||
CDS_position | ?-1533 | |||||||
Protein_position | ?-511 | |||||||
Intron_number | 5-9/10 | |||||||
Exon_number | 6-10/11 | |||||||
Interactor | WBInteraction000543106 | |||||||
WBInteraction000543107 | ||||||||
WBInteraction000557017 | ||||||||
WBInteraction000564464 | ||||||||
Genetics | Mapping_data | In_multi_point | 4520 | |||||
Description | Phenotype | WBPhenotype:0000033 | Paper_evidence | WBPaper00051068 | ||||
Curator_confirmed | WBPerson7188 | |||||||
Remark | Figure 3. Population density-dependent acceleration of development (Pdda) is increased. | Paper_evidence | WBPaper00051068 | |||||
Curator_confirmed | WBPerson7188 | |||||||
Figure 3. Worms do not respond to population density-dependent acceleration of development (Pdda) | Paper_evidence | WBPaper00051068 | ||||||
Curator_confirmed | WBPerson7188 | |||||||
WBPhenotype:0000486 | Paper_evidence | WBPaper00004723 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | nhr-8(ok186) homozygotes are more sensitive than wild-type animals to the toxins colchicine | Paper_evidence | WBPaper00004723 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00004723 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | 0-3.5 mM Colchicine | Paper_evidence | WBPaper00004723 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000488 | Paper_evidence | WBPaper00004723 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | nhr-8(ok186) homozygotes are more sensitive than wild-type animals to the toxin chloroquine | Paper_evidence | WBPaper00004723 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00004723 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Affected_by | Molecule | WBMol:00001530 | Paper_evidence | WBPaper00004723 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | 0-8 mM chloroquine | Paper_evidence | WBPaper00004723 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00059728 | ||||||
Curator_confirmed | WBPerson49407 | |||||||
Remark | (Figure 3E-I, S7) This mutant was more exhibited increase susceptibility to pathogen compared to N2 control animals | Paper_evidence | WBPaper00059728 | |||||
Curator_confirmed | WBPerson49407 | |||||||
WBPhenotype:0001739 | Paper_evidence | WBPaper00045724 | ||||||
Curator_confirmed | WBPerson4671 | |||||||
Remark | unable to respond to dietary restriction | Paper_evidence | WBPaper00045724 | |||||
Curator_confirmed | WBPerson4671 | |||||||
WBPhenotype:0001973 | Paper_evidence | WBPaper00045724 | ||||||
Curator_confirmed | WBPerson4671 | |||||||
Remark | Large amount of germ cells in the transition zone upon dietary restriction | Paper_evidence | WBPaper00045724 | |||||
Curator_confirmed | WBPerson4671 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00004723 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Homozygous nhr-8(ok186) animals are viable | Paper_evidence | WBPaper00004723 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00004723 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000114 | Paper_evidence | WBPaper00004723 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | pgp-3 mRNA levels are not dramatically altered in nhr-8(ok186) mutants | Paper_evidence | WBPaper00004723 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00004723 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00004723 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | nhr-8(ok186), animals are not more sensitive than wild-type to Pseudomonas aeruginosa | Paper_evidence | WBPaper00004723 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00004723 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | 6 hr of exposure to the PA14 strain of P. aeruginosa | Paper_evidence | WBPaper00004723 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001838 | Paper_evidence | WBPaper00031850 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | The gene expression toxin response to fluoranthene and beta-naphtoflavone at the L4 larval stage is largely unaffected by the nhr-8(ok186) mutation (Table S8, Figure S3C). | Paper_evidence | WBPaper00031850 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00004956 | Paper_evidence | WBPaper00031850 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBMol:00001621 | Paper_evidence | WBPaper00031850 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00031850 | |||||||
WBPaper00004723 | ||||||||
WBPaper00045724 | ||||||||
WBPaper00051068 | ||||||||
WBPaper00059728 | ||||||||
Remark | Last updated on 29 Nov 2002 | |||||||
Knockout originally requested for F33D4.1 before it was renamed to F33D4.1a/b | ||||||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |