WormBase Tree Display for Variation: WBVar00091497
expand all nodes | collapse all nodes | view schema
WBVar00091497 | Evidence | Paper_evidence | WBPaper00004723 | ||
---|---|---|---|---|---|
Name | Public_name | ok186 | |||
Other_name | F33D4.1a.1:c.564+20_1533del | ||||
F33D4.1b.1:c.561+23_1530del | |||||
HGVSg | CHROMOSOME_IV:g.7712653_7714019del | ||||
Sequence_details | SMap | S_parent | Sequence | F33D4 | |
Flanking_sequences | caacagctgtggttagtagagtttaaaata | ggtaaatcacgtgctgacattgcatacagt | |||
Mapping_target | F33D4 | ||||
Type_of_mutation | Deletion | ||||
PCR_product | ok186_external | ||||
ok186_internal | |||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00000059 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00171604 | |||
WBGene00003607 | |||||
Transcript | F33D4.10 | ||||
F33D4.1b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||
VEP_impact | HIGH | ||||
HGVSc | F33D4.1b.1:c.561+23_1530del | ||||
cDNA_position | ?-1691 | ||||
CDS_position | ?-1530 | ||||
Protein_position | ?-510 | ||||
Intron_number | 5-9/10 | ||||
Exon_number | 6-10/11 | ||||
F33D4.1a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||
VEP_impact | HIGH | ||||
HGVSc | F33D4.1a.1:c.564+20_1533del | ||||
cDNA_position | ?-1699 | ||||
CDS_position | ?-1533 | ||||
Protein_position | ?-511 | ||||
Intron_number | 5-9/10 | ||||
Exon_number | 6-10/11 | ||||
Interactor | WBInteraction000543106 | ||||
WBInteraction000543107 | |||||
WBInteraction000557017 | |||||
WBInteraction000564464 | |||||
Genetics | Mapping_data | In_multi_point | 4520 | ||
Description (2) | |||||
Reference | WBPaper00031850 | ||||
WBPaper00004723 | |||||
WBPaper00045724 | |||||
WBPaper00051068 | |||||
WBPaper00059728 | |||||
Remark | Last updated on 29 Nov 2002 | ||||
Knockout originally requested for F33D4.1 before it was renamed to F33D4.1a/b | |||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |