WormBase Tree Display for Variation: WBVar00091464
expand all nodes | collapse all nodes | view schema
| WBVar00091464 | Name | Public_name | ok79 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Sequence_details | Flanking_sequences | aaaatcgataagtagtgacgtgtacgaatc | tcgttatacagcaaagaggaaaggaaaatt | ||||||
| Type_of_mutation | Deletion | ||||||||
| SeqStatus | Sequenced | ||||||||
| Deletion_verification | See WBPaper00003166 and WBPaper00060301 for primer sequences and PCR setup | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00000277 | ||||||||
| WBStrain00007860 | |||||||||
| WBStrain00048298 | |||||||||
| Laboratory | RB | ||||||||
| Person | WBPerson46 | ||||||||
| KO_consortium_allele | |||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00004985 | |||||||
| Interactor | WBInteraction000051717 | ||||||||
| WBInteraction000501352 | |||||||||
| WBInteraction000520837 | |||||||||
| WBInteraction000557588 | |||||||||
| Description | Phenotype | WBPhenotype:0000571 | Paper_evidence | WBPaper00032296 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Late pachytene nuclei exhibited more than one ZHP-3 focus per chromosome, unlike similarly staged nuclei in wild-type animals. ZHP-3 persisted along the full length of the SC until diplotene, as assayed by anti-ZHP-3 staining. ZHP-3::GFP foci were not observed, as assayed by staining with antibodies against GFP. | Paper_evidence | WBPaper00032296 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Genotype | Ppie-1::zhp-3::gfp | Paper_evidence | WBPaper00032296 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001377 | Paper_evidence | WBPaper00032296 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | ZHP-3::GFP foci were not observed in late pachytene, as assayed by antibody staining against GFP. | Paper_evidence | WBPaper00032296 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Genotype | zhp-3(jj61);Ppie-1::zhp-3::gfp | Paper_evidence | WBPaper00032296 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_not_observed | WBPhenotype:0001851 | Paper_evidence | WBPaper00027700 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Mutants did not display significant radiosensitivity when compared with WT N2 C. elegans | Paper_evidence | WBPaper00027700 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00027700 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00027700 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | 100-400 Gy radiation | Paper_evidence | WBPaper00027700 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001946 | Paper_evidence | WBPaper00031318 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | The extent of diphosphorylated activated form of MPK-1 (dpMPK-1) staining and the proportion of pachytene-stage germ cells is similar to wild type. | Paper_evidence | WBPaper00031318 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00027700 | ||||||||
| WBPaper00031318 | |||||||||
| WBPaper00025813 | |||||||||
| WBPaper00032296 | |||||||||
| WBPaper00060301 | |||||||||
| WBPaper00003166 | |||||||||
| WBPaper00064961 | |||||||||
| Remark | [210226 skd] The deletion was sequenced and found to remove 982 bases upstream of the predicted start codon, plus the first 245 coding bases. | Curator_confirmed | WBPerson51134 | ||||||
| Primers and PCR conditions for genotyping are also provided in Table S5 in WBPaper00060301 | Paper_evidence | WBPaper00060301 | |||||||
| Curator_confirmed | WBPerson51134 | ||||||||
| Method | KO_consortium_allele |
