WormBase Tree Display for Variation: WBVar00091464
expand all nodes | collapse all nodes | view schema
WBVar00091464 | Name | Public_name | ok79 | ||||||
---|---|---|---|---|---|---|---|---|---|
Sequence_details | Flanking_sequences | aaaatcgataagtagtgacgtgtacgaatc | tcgttatacagcaaagaggaaaggaaaatt | ||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Deletion_verification | See WBPaper00003166 and WBPaper00060301 for primer sequences and PCR setup | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00000277 | ||||||||
WBStrain00007860 | |||||||||
WBStrain00048298 | |||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004985 | |||||||
Interactor | WBInteraction000051717 | ||||||||
WBInteraction000501352 | |||||||||
WBInteraction000520837 | |||||||||
WBInteraction000557588 | |||||||||
Description | Phenotype | WBPhenotype:0000571 | Paper_evidence | WBPaper00032296 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Late pachytene nuclei exhibited more than one ZHP-3 focus per chromosome, unlike similarly staged nuclei in wild-type animals. ZHP-3 persisted along the full length of the SC until diplotene, as assayed by anti-ZHP-3 staining. ZHP-3::GFP foci were not observed, as assayed by staining with antibodies against GFP. | Paper_evidence | WBPaper00032296 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | Ppie-1::zhp-3::gfp | Paper_evidence | WBPaper00032296 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001377 | Paper_evidence | WBPaper00032296 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ZHP-3::GFP foci were not observed in late pachytene, as assayed by antibody staining against GFP. | Paper_evidence | WBPaper00032296 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | zhp-3(jj61);Ppie-1::zhp-3::gfp | Paper_evidence | WBPaper00032296 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0001851 | Paper_evidence | WBPaper00027700 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants did not display significant radiosensitivity when compared with WT N2 C. elegans | Paper_evidence | WBPaper00027700 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00027700 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00027700 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 100-400 Gy radiation | Paper_evidence | WBPaper00027700 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001946 | Paper_evidence | WBPaper00031318 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The extent of diphosphorylated activated form of MPK-1 (dpMPK-1) staining and the proportion of pachytene-stage germ cells is similar to wild type. | Paper_evidence | WBPaper00031318 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (7) | |||||||||
Remark | [210226 skd] The deletion was sequenced and found to remove 982 bases upstream of the predicted start codon, plus the first 245 coding bases. | Curator_confirmed | WBPerson51134 | ||||||
Primers and PCR conditions for genotyping are also provided in Table S5 in WBPaper00060301 | Paper_evidence | WBPaper00060301 | |||||||
Curator_confirmed | WBPerson51134 | ||||||||
Method | KO_consortium_allele |