WormBase Tree Display for Variation: WBVar00090633
expand all nodes | collapse all nodes | view schema
| WBVar00090633 | Evidence | Paper_evidence | WBPaper00028753 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | n2990 | |||||||
| Other_name | JC8.6b.1:c.737G>A | ||||||||
| JC8.6c.1:c.746G>A | |||||||||
| JC8.6d.1:c.746G>A | |||||||||
| CE17990:p.Gly246Glu | |||||||||
| CE53077:p.Gly249Glu | |||||||||
| JC8.6a.1:c.755G>A | |||||||||
| CE17989:p.Gly252Glu | |||||||||
| CE53011:p.Gly249Glu | |||||||||
| HGVSg | CHROMOSOME_IV:g.13242011G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | JC8 | |||||
| Flanking_sequences | ttaccgacatcgaacgtcttcatcagaaag | atgtcactgtaaaaagagtggttgtctgaa | |||||||
| Mapping_target | JC8 | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00028753 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Laboratory | MT | ||||||||
| Status | Live | ||||||||
| Linked_to | WBVar01473673 | ||||||||
| Affects | Gene | WBGene00003037 | |||||||
| Transcript | JC8.6d.1 (12) | ||||||||
| JC8.6b.1 (12) | |||||||||
| JC8.6c.1 (12) | |||||||||
| JC8.6a.1 (12) | |||||||||
| Interactor | WBInteraction000052300 | ||||||||
| Genetics | Interpolated_map_position | IV | 8.48402 | ||||||
| Description | Phenotype | WBPhenotype:0000504 | Paper_evidence | WBPaper00038427 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "lin-54 mutants also exhibit inappropriately connected gut nuclei (right), which may result from defects in mitotic chromosome segregation." (Figure S3A) | Paper_evidence | WBPaper00038427 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005772 | PATO:0000460 | Paper_evidence | WBPaper00038427 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000668 | Paper_evidence | WBPaper00038427 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Figure S3A | Paper_evidence | WBPaper00038427 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000717 | Paper_evidence | WBPaper00038427 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Table S2, embryo microarray: "We identified 678 genes whose transcripts increased at least 1.5-fold in mutant embryos (Figure 4A, Table S2)... Fewer genes showed reduced expression in mutant embryos (299, Figure 4A)." | Paper_evidence | WBPaper00038427 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00038427 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Treatment | "To identify genes regulated by LIN-54 in vivo, we performed microarray expression profiling analysis of wild-type and lin-54 mutant C. elegans embryos and of isolated germlines. We chose embryos because they consist primarily of somatic cells, at a developmental stage with both active cell divisions and dynamic developmental gene expression programs." | Paper_evidence | WBPaper00038427 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001372 | Paper_evidence | WBPaper00038427 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark (2) | |||||||||
| Phenotype_not_observed | WBPhenotype:0000112 | Paper_evidence | WBPaper00038427 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "Control experiments showed that wild-type and lin- 54(n2990) mutant animals produce a comparable amount of fulllength, nuclear-localized LIN-54 protein (Figure 2A and 2B), unlike lin-54(n3423) null animals which produce no detectable LIN-54 protein and reduced amounts of other DRM subunits (Figure 2B and [4])." | Paper_evidence | WBPaper00038427 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000436 | Paper_evidence | WBPaper00038427 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "Control experiments showed that wild-type and lin- 54(n2990) mutant animals produce a comparable amount of fulllength, nuclear-localized LIN-54 protein (Figure 2A and 2B), unlike lin-54(n3423) null animals which produce no detectable LIN-54 protein and reduced amounts of other DRM subunits (Figure 2B and [4])." | Paper_evidence | WBPaper00038427 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Reference | WBPaper00038427 | ||||||||
| WBPaper00005861 | |||||||||
| Remark | Allele incorrected cited as n2290 in a couple of places | Paper_evidence | WBPaper00038427 | ||||||
| Method | Substitution_allele |
