WormBase Tree Display for Variation: WBVar00089738
expand all nodes | collapse all nodes | view schema
WBVar00089738 | Evidence | Paper_evidence | WBPaper00001949 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | n767 | |||||
Other_name | ZK678.1.1:c.994_1113delinsAAAAAAAAAAAA | ||||||
CE15383:p.Arg332_Ter371delinsLysLysLysLys | |||||||
HGVSg | CHROMOSOME_X:g.15734038_15734215delinsAAAAAAAAAAAA | ||||||
Sequence_details | SMap | S_parent | Sequence | ZK678 | |||
Flanking_sequences | tcattcaagaattccattaaatcttattac | aatcataatcttagcctcagtgatgctgat | |||||
Mapping_target | ZK678 | ||||||
Type_of_mutation | Insertion | aaaaaaaaaaaa | Paper_evidence | WBPaper00001949 | |||
Deletion | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00026879 | ||||||
WBStrain00026900 | |||||||
WBStrain00027237 | |||||||
WBStrain00027359 | |||||||
WBStrain00027374 | |||||||
WBStrain00027399 | |||||||
WBStrain00027524 | |||||||
WBStrain00027555 | |||||||
WBStrain00027561 | |||||||
Laboratory | MT | ||||||
Status | Live | ||||||
Linked_to | WBVar02143804 | ||||||
Affects | Gene | WBGene00023498 | |||||
Transcript | ZK678.1.1 (11) | ||||||
Interactor (112) | |||||||
Genetics | Interpolated_map_position | X | 22.9461 | ||||
Mapping_data | In_multi_point | 2660 | |||||
Description | Phenotype | WBPhenotype:0000425 | Paper_evidence | WBPaper00037906 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | LIN-15A nuclear staining is greatly reduced in these mutants. | Paper_evidence | WBPaper00037906 | ||||
Curator_confirmed | WBPerson712 | ||||||
Phenotype_not_observed | WBPhenotype:0000059 | Paper_evidence | WBPaper00038168 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals do not show larval arrest at 24 or 26 deg C. | Paper_evidence | WBPaper00038168 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000134 | Paper_evidence | WBPaper00037906 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | LIN-15A RNA levels are not reduced in these mutants compared to wild type, as measured through RT-PCR. | Paper_evidence | WBPaper00037906 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00038257 | |||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000886 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | class A allele, wildtype alone, Muv in homozygotes with lin-9,35,36,37 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001258 | Paper_evidence | WBPaper00027135 | |||||
Curator_confirmed | WBPerson557 | ||||||
Reference (20) | |||||||
Remark | In addition to the deletion and insertion described, allele n767 is comprised of an insertion of an A after the 6th base of the initial insertion and a G to A substitution at the 19th base after this second insertion. | Paper_evidence | WBPaper00001949 | ||||
Method | Deletion_and_insertion_allele |