WormBase Tree Display for Variation: WBVar00089738

WBVar00089738 Evidence: Paper_evidence: WBPaper00001949
  Name: Public_name: n767
    Other_name: ZK678.1.1:c.994_1113delinsAAAAAAAAAAAA
      CE15383:p.Arg332_Ter371delinsLysLysLysLys
    HGVSg: CHROMOSOME_X:g.15734038_15734215delinsAAAAAAAAAAAA
  Sequence_details: SMap: S_parent: Sequence: ZK678
    Flanking_sequences: tcattcaagaattccattaaatcttattac aatcataatcttagcctcagtgatgctgat
    Mapping_target: ZK678
    Type_of_mutation: Insertion: aaaaaaaaaaaa Paper_evidence: WBPaper00001949
      Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00026879
      WBStrain00026900
      WBStrain00027237
      WBStrain00027359
      WBStrain00027374
      WBStrain00027399
      WBStrain00027524
      WBStrain00027555
      WBStrain00027561
    Laboratory: MT
    Status: Live
  Linked_to: WBVar02143804
  Affects: Gene: WBGene00023498
    Transcript: ZK678.1.1 (11)
    Interactor (112)
  Genetics: Interpolated_map_position: X 22.9461
    Mapping_data: In_multi_point: 2660
  Description: Phenotype: WBPhenotype:0000425 Paper_evidence: WBPaper00037906
        Curator_confirmed: WBPerson712
        Remark: LIN-15A nuclear staining is greatly reduced in these mutants. Paper_evidence: WBPaper00037906
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000059 Paper_evidence: WBPaper00038168
        Curator_confirmed: WBPerson712
        Remark: Animals do not show larval arrest at 24 or 26 deg C. Paper_evidence: WBPaper00038168
            Curator_confirmed: WBPerson712
      WBPhenotype:0000134 Paper_evidence: WBPaper00037906
        Curator_confirmed: WBPerson712
        Remark: LIN-15A RNA levels are not reduced in these mutants compared to wild type, as measured through RT-PCR. Paper_evidence: WBPaper00037906
            Curator_confirmed: WBPerson712
      WBPhenotype:0000700 Paper_evidence: WBPaper00038257
        Curator_confirmed: WBPerson712
      WBPhenotype:0000886 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: class A allele, wildtype alone, Muv in homozygotes with lin-9,35,36,37 Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0001258 Paper_evidence: WBPaper00027135
        Curator_confirmed: WBPerson557
  Reference (20)
  Remark: In addition to the deletion and insertion described, allele n767 is comprised of an insertion of an A after the 6th base of the initial insertion and a G to A substitution at the 19th base after this second insertion. Paper_evidence: WBPaper00001949
  Method: Deletion_and_insertion_allele