WormBase Tree Display for Variation: WBVar00089738
expand all nodes | collapse all nodes | view schema
WBVar00089738 | Evidence | Paper_evidence | WBPaper00001949 | |||
---|---|---|---|---|---|---|
Name | Public_name | n767 | ||||
Other_name | ZK678.1.1:c.994_1113delinsAAAAAAAAAAAA | |||||
CE15383:p.Arg332_Ter371delinsLysLysLysLys | ||||||
HGVSg | CHROMOSOME_X:g.15734038_15734215delinsAAAAAAAAAAAA | |||||
Sequence_details | SMap | S_parent | Sequence | ZK678 | ||
Flanking_sequences | tcattcaagaattccattaaatcttattac | aatcataatcttagcctcagtgatgctgat | ||||
Mapping_target | ZK678 | |||||
Type_of_mutation | Insertion | aaaaaaaaaaaa | Paper_evidence | WBPaper00001949 | ||
Deletion | ||||||
SeqStatus | Sequenced | |||||
Variation_type | Allele | |||||
Origin | Species | Caenorhabditis elegans | ||||
Strain | WBStrain00026879 | |||||
WBStrain00026900 | ||||||
WBStrain00027237 | ||||||
WBStrain00027359 | ||||||
WBStrain00027374 | ||||||
WBStrain00027399 | ||||||
WBStrain00027524 | ||||||
WBStrain00027555 | ||||||
WBStrain00027561 | ||||||
Laboratory | MT | |||||
Status | Live | |||||
Linked_to | WBVar02143804 | |||||
Affects | Gene | WBGene00023498 | ||||
Transcript | ZK678.1.1 (11) | |||||
Interactor (112) | ||||||
Genetics | Interpolated_map_position | X | 22.9461 | |||
Mapping_data | In_multi_point | 2660 | ||||
Description (2) | ||||||
Reference (20) | ||||||
Remark | In addition to the deletion and insertion described, allele n767 is comprised of an insertion of an A after the 6th base of the initial insertion and a G to A substitution at the 19th base after this second insertion. | Paper_evidence | WBPaper00001949 | |||
Method | Deletion_and_insertion_allele |