WormBase Tree Display for Variation: WBVar00089738
expand all nodes | collapse all nodes | view schema
| WBVar00089738 | Evidence | Paper_evidence | WBPaper00001949 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | n767 | |||||
| Other_name | ZK678.1.1:c.994_1113delinsAAAAAAAAAAAA | ||||||
| CE15383:p.Arg332_Ter371delinsLysLysLysLys | |||||||
| HGVSg | CHROMOSOME_X:g.15734038_15734215delinsAAAAAAAAAAAA | ||||||
| Sequence_details | SMap | S_parent | Sequence | ZK678 | |||
| Flanking_sequences | tcattcaagaattccattaaatcttattac | aatcataatcttagcctcagtgatgctgat | |||||
| Mapping_target | ZK678 | ||||||
| Type_of_mutation | Insertion | aaaaaaaaaaaa | Paper_evidence | WBPaper00001949 | |||
| Deletion | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00026879 | ||||||
| WBStrain00026900 | |||||||
| WBStrain00027237 | |||||||
| WBStrain00027359 | |||||||
| WBStrain00027374 | |||||||
| WBStrain00027399 | |||||||
| WBStrain00027524 | |||||||
| WBStrain00027555 | |||||||
| WBStrain00027561 | |||||||
| Laboratory | MT | ||||||
| Status | Live | ||||||
| Linked_to | WBVar02143804 | ||||||
| Affects | Gene | WBGene00023498 | |||||
| Transcript | ZK678.1.1 (11) | ||||||
| Interactor (112) | |||||||
| Genetics | Interpolated_map_position | X | 22.9461 | ||||
| Mapping_data | In_multi_point | 2660 | |||||
| Description | Phenotype | WBPhenotype:0000425 | Paper_evidence | WBPaper00037906 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | LIN-15A nuclear staining is greatly reduced in these mutants. | Paper_evidence | WBPaper00037906 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Phenotype_not_observed | WBPhenotype:0000059 | Paper_evidence | WBPaper00038168 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Animals do not show larval arrest at 24 or 26 deg C. | Paper_evidence | WBPaper00038168 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000134 | Paper_evidence | WBPaper00037906 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | LIN-15A RNA levels are not reduced in these mutants compared to wild type, as measured through RT-PCR. | Paper_evidence | WBPaper00037906 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000700 | Paper_evidence | WBPaper00038257 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000886 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | class A allele, wildtype alone, Muv in homozygotes with lin-9,35,36,37 | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0001258 | Paper_evidence | WBPaper00027135 | |||||
| Curator_confirmed | WBPerson557 | ||||||
| Reference | WBPaper00021002 | ||||||
| WBPaper00038168 | |||||||
| WBPaper00038257 | |||||||
| WBPaper00010854 | |||||||
| WBPaper00027135 | |||||||
| WBPaper00010365 | |||||||
| WBPaper00018851 | |||||||
| WBPaper00016243 | |||||||
| WBPaper00016288 | |||||||
| WBPaper00014833 | |||||||
| WBPaper00014218 | |||||||
| WBPaper00015624 | |||||||
| WBPaper00014211 | |||||||
| WBPaper00037906 | |||||||
| WBPaper00014260 | |||||||
| WBPaper00016178 | |||||||
| WBPaper00010946 | |||||||
| WBPaper00025593 | |||||||
| WBPaper00010594 | |||||||
| WBPaper00018852 | |||||||
| Remark | In addition to the deletion and insertion described, allele n767 is comprised of an insertion of an A after the 6th base of the initial insertion and a G to A substitution at the 19th base after this second insertion. | Paper_evidence | WBPaper00001949 | ||||
| Method | Deletion_and_insertion_allele |
