WormBase Tree Display for Variation: WBVar00089625

WBVar00089625 Evidence: Paper_evidence: WBPaper00005774
  Name: Public_name: n612
    Other_name (16)
    HGVSg: CHROMOSOME_IV:g.1877300G>A
  Sequence_details: SMap: S_parent: Sequence: F55A8
    Flanking_sequences: acgattacaccgcccgtttctacgtggcct cgtgctcgagggtctcgaatatctgcatcg
    Mapping_target: F55A8
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00005774
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00026828
    Laboratory: MT
    Status: Live
  Affects: Gene: WBGene00001173
    Transcript: F55A8.2g.1 (12)
      F55A8.2e.1 (12)
      F55A8.2d.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: F55A8.2d.1:c.493-2544G>A
        Intron_number: 3/3
      F55A8.2f.1 (12)
      F55A8.2b.1 (12)
      F55A8.2c.1 (12)
      F55A8.2h.1 (12)
      F55A8.2a.2 (12)
      F55A8.2a.1 (12)
  Genetics: Interpolated_map_position: IV -14.2332
  Description: Phenotype (18)
    Phenotype_not_observed: WBPhenotype:0000249 Paper_evidence: WBPaper00004310
        Curator_confirmed: WBPerson2021
        Remark: egl-4 mutants were found to be wild type in their responses to osmotic shock (data not shown). Paper_evidence: WBPaper00004310
            Curator_confirmed: WBPerson2021
        Recessive: Paper_evidence: WBPaper00004310
          Curator_confirmed: WBPerson2021
      WBPhenotype:0000302 Paper_evidence: WBPaper00004310
        Curator_confirmed: WBPerson2021
        Remark: egl-4 mutants have normal responses to the odorant benzaldehyde Paper_evidence: WBPaper00004310
            Curator_confirmed: WBPerson2021
        Recessive: Paper_evidence: WBPaper00004310
          Curator_confirmed: WBPerson2021
        Affected_by: Molecule: WBMol:00002087 Paper_evidence: WBPaper00004310
              Curator_confirmed: WBPerson2021
      WBPhenotype:0000398 Paper_evidence: WBPaper00004310
        Curator_confirmed: WBPerson2021
        Remark: egl-4 mutants were found to be wild type in their responses to gentle body touch (data not shown). Paper_evidence: WBPaper00004310
            Curator_confirmed: WBPerson2021
        Recessive: Paper_evidence: WBPaper00004310
          Curator_confirmed: WBPerson2021
      WBPhenotype:0000660 Paper_evidence: WBPaper00004310
        Curator_confirmed: WBPerson2021
        Remark: egl-4 mutants exhibit little if any clumpy behavior (iwhere animals tend to congregate in clumps) Paper_evidence: WBPaper00004310
            Curator_confirmed: WBPerson2021
        Recessive: Paper_evidence: WBPaper00004310
          Curator_confirmed: WBPerson2021
      WBPhenotype:0001086 Paper_evidence: WBPaper00004310
        Curator_confirmed: WBPerson2021
        Remark: All egl-4 mutants except n478 exhibit wild-type response to trimethylthiazole Paper_evidence: WBPaper00004310
            Curator_confirmed: WBPerson2021
        Recessive: Paper_evidence: WBPaper00004310
          Curator_confirmed: WBPerson2021
        Affected_by: Molecule: WBMol:00004538 Paper_evidence: WBPaper00004310
              Curator_confirmed: WBPerson2021
      WBPhenotype:0001221 Paper_evidence: WBPaper00004310
        Curator_confirmed: WBPerson2021
        Remark: egl-4 mutants were found to be wild type in their responses to nose touch (data not shown). Paper_evidence: WBPaper00004310
            Curator_confirmed: WBPerson2021
        Recessive: Paper_evidence: WBPaper00004310
          Curator_confirmed: WBPerson2021
      WBPhenotype:0001448 Paper_evidence: WBPaper00004310
        Curator_confirmed: WBPerson2021
        Remark: egl-4 mutants were found to be wild type in their responses to volatile repellents (data not shown). Paper_evidence: WBPaper00004310
            Curator_confirmed: WBPerson2021
        Recessive: Paper_evidence: WBPaper00004310
          Curator_confirmed: WBPerson2021
      WBPhenotype:0002535 Paper_evidence: WBPaper00004310
        Curator_confirmed: WBPerson2021
        Remark: egl-4 mutants dye-fill normally and no obvious defects in the morphology of the neurons were visible (data not shown). Paper_evidence: WBPaper00004310
            Curator_confirmed: WBPerson2021
        Recessive: Paper_evidence: WBPaper00004310
          Curator_confirmed: WBPerson2021
  Reference: WBPaper00004310
    WBPaper00000635
    WBPaper00017625
    WBPaper00011220
    WBPaper00023070
  Method: Substitution_allele