WormBase Tree Display for Variation: WBVar00089625
expand all nodes | collapse all nodes | view schema
WBVar00089625 | Evidence | Paper_evidence | WBPaper00005774 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | n612 | ||||||
Other_name (16) | ||||||||
HGVSg | CHROMOSOME_IV:g.1877300G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | F55A8 | ||||
Flanking_sequences | acgattacaccgcccgtttctacgtggcct | cgtgctcgagggtctcgaatatctgcatcg | ||||||
Mapping_target | F55A8 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005774 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00026828 | |||||||
Laboratory | MT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001173 | ||||||
Transcript | F55A8.2g.1 (12) | |||||||
F55A8.2e.1 (12) | ||||||||
F55A8.2d.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | F55A8.2d.1:c.493-2544G>A | |||||||
Intron_number | 3/3 | |||||||
F55A8.2f.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | |||||||
SIFT | 0 | deleterious_low_confidence | ||||||
PolyPhen | 1 | probably_damaging | ||||||
HGVSc | F55A8.2f.1:c.797G>A | |||||||
HGVSp | CE37242:p.Cys266Tyr | |||||||
cDNA_position | 925 | |||||||
CDS_position | 797 | |||||||
Protein_position | 266 | |||||||
Exon_number | 5/6 | |||||||
Codon_change | tGc/tAc | |||||||
Amino_acid_change | C/Y | |||||||
F55A8.2b.1 (12) | ||||||||
F55A8.2c.1 (12) | ||||||||
F55A8.2h.1 (12) | ||||||||
F55A8.2a.2 (12) | ||||||||
F55A8.2a.1 (12) | ||||||||
Genetics | Interpolated_map_position | IV | -14.2332 | |||||
Description | Phenotype (18) | |||||||
Phenotype_not_observed | WBPhenotype:0000249 | Paper_evidence | WBPaper00004310 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | egl-4 mutants were found to be wild type in their responses to osmotic shock (data not shown). | Paper_evidence | WBPaper00004310 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000302 | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | egl-4 mutants have normal responses to the odorant benzaldehyde | Paper_evidence | WBPaper00004310 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Affected_by | Molecule | WBMol:00002087 | Paper_evidence | WBPaper00004310 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000398 | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | egl-4 mutants were found to be wild type in their responses to gentle body touch (data not shown). | Paper_evidence | WBPaper00004310 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000660 | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | egl-4 mutants exhibit little if any clumpy behavior (iwhere animals tend to congregate in clumps) | Paper_evidence | WBPaper00004310 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001086 | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | All egl-4 mutants except n478 exhibit wild-type response to trimethylthiazole | Paper_evidence | WBPaper00004310 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Affected_by | Molecule | WBMol:00004538 | Paper_evidence | WBPaper00004310 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001221 | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | egl-4 mutants were found to be wild type in their responses to nose touch (data not shown). | Paper_evidence | WBPaper00004310 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001448 | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | egl-4 mutants were found to be wild type in their responses to volatile repellents (data not shown). | Paper_evidence | WBPaper00004310 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | egl-4 mutants dye-fill normally and no obvious defects in the morphology of the neurons were visible (data not shown). | Paper_evidence | WBPaper00004310 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00004310 | |||||||
WBPaper00000635 | ||||||||
WBPaper00017625 | ||||||||
WBPaper00011220 | ||||||||
WBPaper00023070 | ||||||||
Method | Substitution_allele |