WormBase Tree Display for Variation: WBVar00089524

WBVar00089524 Evidence: Paper_evidence: WBPaper00005774
  Name: Public_name: n477
  Sequence_details: SMap: S_parent: Sequence: F55A8
    Flanking_sequences: gtcgacgacttccgagaggagtttgcacag ctgaaaaatgtgaagaggctagcgacactt
    Mapping_target: F55A8
    Type_of_mutation: Insertion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00026778
    Laboratory: MT
    Status: Live
  Affects: Gene: WBGene00001173
    Transcript: F55A8.2g.1
      F55A8.2d.1
      F55A8.2e.1
      F55A8.2f.1
      F55A8.2b.1
      F55A8.2c.1
      F55A8.2a.2
      F55A8.2h.1
      F55A8.2a.1
    Interactor: WBInteraction000500289
  Genetics: Interpolated_map_position: IV -14.2686
  Description: Phenotype (20)
    Phenotype_not_observed: WBPhenotype:0000249 Paper_evidence: WBPaper00004310
        Curator_confirmed: WBPerson2021
        Remark: egl-4 mutants were found to be wild type in their responses to osmotic shock (data not shown). Paper_evidence: WBPaper00004310
            Curator_confirmed: WBPerson2021
        Recessive: Paper_evidence: WBPaper00004310
          Curator_confirmed: WBPerson2021
      WBPhenotype:0000302 Paper_evidence: WBPaper00004310
        Curator_confirmed: WBPerson2021
        Remark: egl-4 mutants have normal responses to the odorant benzaldehyde Paper_evidence: WBPaper00004310
            Curator_confirmed: WBPerson2021
        Recessive: Paper_evidence: WBPaper00004310
          Curator_confirmed: WBPerson2021
        Affected_by: Molecule: WBMol:00002087 Paper_evidence: WBPaper00004310
              Curator_confirmed: WBPerson2021
      WBPhenotype:0000398 Paper_evidence: WBPaper00004310
        Curator_confirmed: WBPerson2021
        Remark: egl-4 mutants were found to be wild type in their responses to gentle body touch (data not shown). Paper_evidence: WBPaper00004310
            Curator_confirmed: WBPerson2021
        Recessive: Paper_evidence: WBPaper00004310
          Curator_confirmed: WBPerson2021
      WBPhenotype:0000660 Paper_evidence: WBPaper00004310
        Curator_confirmed: WBPerson2021
        Remark: egl-4 mutants exhibit little if any clumpy behavior (iwhere animals tend to congregate in clumps) Paper_evidence: WBPaper00004310
            Curator_confirmed: WBPerson2021
        Recessive: Paper_evidence: WBPaper00004310
          Curator_confirmed: WBPerson2021
      WBPhenotype:0001086 Paper_evidence: WBPaper00004310
        Curator_confirmed: WBPerson2021
        Remark: All egl-4 mutants except n478 exhibit wild-type response to trimethylthiazole Paper_evidence: WBPaper00004310
            Curator_confirmed: WBPerson2021
        Recessive: Paper_evidence: WBPaper00004310
          Curator_confirmed: WBPerson2021
        Affected_by: Molecule: WBMol:00004538 Paper_evidence: WBPaper00004310
              Curator_confirmed: WBPerson2021
      WBPhenotype:0001221 Paper_evidence: WBPaper00004310
        Curator_confirmed: WBPerson2021
        Remark: egl-4 mutants were found to be wild type in their responses to nose touch (data not shown). Paper_evidence: WBPaper00004310
            Curator_confirmed: WBPerson2021
        Recessive: Paper_evidence: WBPaper00004310
          Curator_confirmed: WBPerson2021
      WBPhenotype:0001448 Paper_evidence: WBPaper00004310
        Curator_confirmed: WBPerson2021
        Remark: egl-4 mutants were found to be wild type in their responses to volatile repellents (data not shown). Paper_evidence: WBPaper00004310
            Curator_confirmed: WBPerson2021
        Recessive: Paper_evidence: WBPaper00004310
          Curator_confirmed: WBPerson2021
      WBPhenotype:0002535 Paper_evidence: WBPaper00004310
        Curator_confirmed: WBPerson2021
        Remark: egl-4 mutants dye-fill normally and no obvious defects in the morphology of the neurons were visible (data not shown). Paper_evidence: WBPaper00004310
            Curator_confirmed: WBPerson2021
        Recessive: Paper_evidence: WBPaper00004310
          Curator_confirmed: WBPerson2021
      WBPhenotype:0004030 Paper_evidence: WBPaper00061691
        Curator_confirmed: WBPerson712
        Remark: "egl-4 loss-of-function mutant males tended to respond slightly less efficiently than wild-type males in standard response assays...but in the presence of a large excess of hermaphrodites almost all egl-4 mutant males were able to respond" Paper_evidence: WBPaper00061691
            Curator_confirmed: WBPerson712
  Reference: WBPaper00004310
    WBPaper00010745
    WBPaper00000635
    WBPaper00017625
    WBPaper00010687
    WBPaper00011220
    WBPaper00023070
    WBPaper00035944
    WBPaper00018461
    WBPaper00061691
  Remark: Flanking sequences are based on 30 bp to the left and right of V464 and T465 Curator_confirmed: WBPerson1845
    n477 has an eight-base pair insertion between V464 and T465, which causes a frameshift and a stop codon and leads to loss of the kinase domain Paper_evidence: WBPaper00005774
  Method: Insertion_allele