WormBase Tree Display for Variation: WBVar00089524
expand all nodes | collapse all nodes | view schema
| WBVar00089524 | Evidence | Paper_evidence | WBPaper00005774 | ||
|---|---|---|---|---|---|
| Name | Public_name | n477 | |||
| Sequence_details | SMap | S_parent | Sequence | F55A8 | |
| Flanking_sequences | gtcgacgacttccgagaggagtttgcacag | ctgaaaaatgtgaagaggctagcgacactt | |||
| Mapping_target | F55A8 | ||||
| Type_of_mutation | Insertion | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00026778 | ||||
| Laboratory | MT | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00001173 | |||
| Transcript | F55A8.2g.1 | ||||
| F55A8.2d.1 | |||||
| F55A8.2e.1 | |||||
| F55A8.2f.1 | |||||
| F55A8.2b.1 | |||||
| F55A8.2c.1 | |||||
| F55A8.2a.2 | |||||
| F55A8.2h.1 | |||||
| F55A8.2a.1 | |||||
| Interactor | WBInteraction000500289 | ||||
| Genetics | Interpolated_map_position | IV | -14.2686 | ||
| Description | Phenotype (20) | ||||
| Phenotype_not_observed (9) | |||||
| Reference | WBPaper00004310 | ||||
| WBPaper00010745 | |||||
| WBPaper00000635 | |||||
| WBPaper00017625 | |||||
| WBPaper00010687 | |||||
| WBPaper00011220 | |||||
| WBPaper00023070 | |||||
| WBPaper00035944 | |||||
| WBPaper00018461 | |||||
| WBPaper00061691 | |||||
| Remark | Flanking sequences are based on 30 bp to the left and right of V464 and T465 | Curator_confirmed | WBPerson1845 | ||
| n477 has an eight-base pair insertion between V464 and T465, which causes a frameshift and a stop codon and leads to loss of the kinase domain | Paper_evidence | WBPaper00005774 | |||
| Method | Insertion_allele |
