WormBase Tree Display for Variation: WBVar00088877
expand all nodes | collapse all nodes | view schema
| WBVar00088877 | Evidence | Paper_evidence | WBPaper00027081 | |||||
|---|---|---|---|---|---|---|---|---|
| Name | Public_name | me66 | ||||||
| Other_name | C25E10.9.1:c.239G>A | |||||||
| CE06871:p.Cys80Tyr | ||||||||
| HGVSg | CHROMOSOME_V:g.9054437C>T | |||||||
| Sequence_details | SMap | S_parent | Sequence | C25E10 | ||||
| Flanking_sequences | tatctgaatgcaccaaggaaactacaaaat | cccagaaaatgagacattctttggctgtgg | ||||||
| Mapping_target | C25E10 | |||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00027081 | |||
| SeqStatus | Sequenced | |||||||
| Variation_type | Allele | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Strain | WBStrain00000289 | |||||||
| Laboratory | AV | |||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00023417 | ||||||
| Transcript | C25E10.9.1 (12) | |||||||
| Interactor | WBInteraction000501188 | |||||||
| Genetics | Interpolated_map_position | V | 1.9142 | |||||
| Description | Phenotype | WBPhenotype:0000284 | Paper_evidence | WBPaper00027081 | ||||
| Curator_confirmed | WBPerson48 | |||||||
| WBPhenotype:0000863 | Paper_evidence | WBPaper00027081 | ||||||
| Curator_confirmed | WBPerson48 | |||||||
| WBPhenotype:0001829 | Paper_evidence | WBPaper00040337 | ||||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Prematurely activated spermatozoa are easily observable in swm-1 mutant males (Stanfield and Villeneuve 2006). Analysis of the treadmilling rate, which directly correlates to spermmovement rate (Nelson et al. 1982), of swm-1(me66) him-5(e1490) spermatozoa is 20.72 +/-7.08 um/min. | Paper_evidence | WBPaper00040337 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Phenotype_assay | Genotype | him-5(e1490) | Paper_evidence | WBPaper00040337 | ||||
| Curator_confirmed | WBPerson712 | |||||||
| Reference | WBPaper00040337 | |||||||
| WBPaper00027081 | ||||||||
| Method | Substitution_allele |
