WormBase Tree Display for Variation: WBVar00088877
expand all nodes | collapse all nodes | view schema
WBVar00088877 | Evidence | Paper_evidence | WBPaper00027081 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | me66 | ||||||
Other_name | C25E10.9.1:c.239G>A | |||||||
CE06871:p.Cys80Tyr | ||||||||
HGVSg | CHROMOSOME_V:g.9054437C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | C25E10 | ||||
Flanking_sequences | tatctgaatgcaccaaggaaactacaaaat | cccagaaaatgagacattctttggctgtgg | ||||||
Mapping_target | C25E10 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00027081 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00000289 | |||||||
Laboratory | AV | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00023417 | ||||||
Transcript | C25E10.9.1 | VEP_consequence | missense_variant | |||||
VEP_impact | MODERATE | |||||||
SIFT | 0 | deleterious | ||||||
PolyPhen | 1 | probably_damaging | ||||||
HGVSc | C25E10.9.1:c.239G>A | |||||||
HGVSp | CE06871:p.Cys80Tyr | |||||||
cDNA_position | 278 | |||||||
CDS_position | 239 | |||||||
Protein_position | 80 | |||||||
Exon_number | 5/6 | |||||||
Codon_change | tGc/tAc | |||||||
Amino_acid_change | C/Y | |||||||
Interactor | WBInteraction000501188 | |||||||
Genetics | Interpolated_map_position | V | 1.9142 | |||||
Description | Phenotype | WBPhenotype:0000284 | Paper_evidence | WBPaper00027081 | ||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000863 | Paper_evidence | WBPaper00027081 | ||||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001829 | Paper_evidence | WBPaper00040337 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Prematurely activated spermatozoa are easily observable in swm-1 mutant males (Stanfield and Villeneuve 2006). Analysis of the treadmilling rate, which directly correlates to spermmovement rate (Nelson et al. 1982), of swm-1(me66) him-5(e1490) spermatozoa is 20.72 +/-7.08 um/min. | Paper_evidence | WBPaper00040337 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | him-5(e1490) | Paper_evidence | WBPaper00040337 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00040337 | |||||||
WBPaper00027081 | ||||||||
Method | Substitution_allele |