WormBase Tree Display for Variation: WBVar00088446

WBVar00088446 Evidence: Paper_evidence: WBPaper00004669
  Name: Public_name: ky397
    Other_name: CE50862:p.Gln1092Ter
      CE44901:p.Gln1109Ter
      F59A6.1b.1:c.3274C>T
      F59A6.1a.1:c.3325C>T
    HGVSg: CHROMOSOME_II:g.5028087C>T
  Sequence_details: SMap: S_parent: Sequence: F33G12
    Flanking_sequences: tccaatagttcaagtcgattcttcatgctt aaaaggattcagaacgtagaagatccttgg
    Mapping_target: F33G12
    Type_of_mutation: Substitution: c t
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00005266
      WBStrain00040556
    Laboratory: CX
    Status: Live
  Affects: Gene: WBGene00003822
    Transcript: F59A6.1a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: F59A6.1a.1:c.3325C>T
        HGVSp: CE44901:p.Gln1109Ter
        cDNA_position: 3482
        CDS_position: 3325
        Protein_position: 1109
        Exon_number: 9/12
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      F59A6.1b.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: F59A6.1b.1:c.3274C>T
        HGVSp: CE50862:p.Gln1092Ter
        cDNA_position: 3274
        CDS_position: 3274
        Protein_position: 1092
        Exon_number: 8/11
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
    Interactor: WBInteraction000503570
      WBInteraction000504062
  Genetics: Interpolated_map_position: II -2.5918
  Description: Phenotype: WBPhenotype:0000006 Paper_evidence: WBPaper00003760
        Curator_confirmed: WBPerson2021
        Remark: nsy-1 mutants are egg-laying defective Paper_evidence: WBPaper00003760
            Curator_confirmed: WBPerson2021
        Recessive: Paper_evidence: WBPaper00003760
          Curator_confirmed: WBPerson2021
      WBPhenotype:0000142 Paper_evidence: WBPaper00031666
        Curator_confirmed: WBPerson712
        Remark: Upregulation of pnlp-29::GFP after infection with D. coniospora or after wounding was markedly decreased from that observed for wild type animals. Paper_evidence: WBPaper00031666
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Animals were infected with D. coniospora at the L4 stage and maintained on OP50 at 20C. Animals were wounded by microinjection needle pricking of the cuticle or by femtosecond laser busts. Paper_evidence: WBPaper00031666
              Curator_confirmed: WBPerson712
          Genotype: frIs7 Paper_evidence: WBPaper00031666
              Curator_confirmed: WBPerson712
      WBPhenotype:0001013 Paper_evidence: WBPaper00005370
          WBPaper00041562
        Curator_confirmed: WBPerson712
          WBPerson6515
        Remark: Animals were also hypersusceptible to PA14 killing. Paper_evidence: WBPaper00005370
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Approximately 25 L4-stage worms were placed on each of three agar plates with PA14 lawns under standard slow killing (SK) assay conditions. Survival was assayed after 30 hours. Paper_evidence: WBPaper00005370
              Curator_confirmed: WBPerson712
      WBPhenotype:0001073 Paper_evidence: WBPaper00035315
        Curator_confirmed: WBPerson2021
        Remark: Egg laying response to food is defective Paper_evidence: WBPaper00035315
            Curator_confirmed: WBPerson2021
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00035315
            Curator_confirmed: WBPerson2021
      WBPhenotype:0001661 Paper_evidence: WBPaper00003760
        Curator_confirmed: WBPerson2021
        Remark: 2 AWC on Paper_evidence: WBPaper00003760
            Curator_confirmed: WBPerson2021
        Recessive: Paper_evidence: WBPaper00003760
          Curator_confirmed: WBPerson2021
        EQ_annotations: Anatomy_term: WBbt:0005672 PATO:0000460 Paper_evidence: WBPaper00003760
                Curator_confirmed: WBPerson2021
      WBPhenotype:0001857 Paper_evidence: WBPaper00035315
        Curator_confirmed: WBPerson2021
        Remark: No induction of Ptph-1::GFP expression by PA14 in the nsy-1(ky397) mutant background. Paper_evidence: WBPaper00035315
            Curator_confirmed: WBPerson2021
    Phenotype_not_observed: WBPhenotype:0000643 Paper_evidence: WBPaper00003760
        Curator_confirmed: WBPerson2021
        Remark: nsy-1 mutants are coordinated Paper_evidence: WBPaper00003760
            Curator_confirmed: WBPerson2021
        Recessive: Paper_evidence: WBPaper00003760
          Curator_confirmed: WBPerson2021
      WBPhenotype:0001173 Paper_evidence: WBPaper00040855
        Curator_confirmed: WBPerson557
        Remark: Adult males show appropriate cell death of the linker cell. Paper_evidence: WBPaper00040855
            Curator_confirmed: WBPerson557
      WBPhenotype:0001660 Paper_evidence: WBPaper00006052
        Curator_confirmed: WBPerson2021
        Remark: No disruption of ASE asymmetry (as seen with lim-6 reporters) Paper_evidence: WBPaper00006052
            Curator_confirmed: WBPerson2021
        Phenotype_assay: Genotype: otIs114, otIs6 Paper_evidence: WBPaper00006052
              Curator_confirmed: WBPerson2021
      WBPhenotype:0001725 Paper_evidence: WBPaper00032031
        Curator_confirmed: WBPerson712
        Remark: Osmotic stress triggered upregulation of nlp-29 was not affected, based on the fluorescent ratio of control to experiment animals. Paper_evidence: WBPaper00032031
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Osmotic stress was done in liquid by incubating young adult worms in 300 mM NaCl for 6 h, with analysis occuring 24 hours later. Paper_evidence: WBPaper00032031
              Curator_confirmed: WBPerson712
          Genotype: frIs7 Paper_evidence: WBPaper00032031
              Curator_confirmed: WBPerson712
  Reference: WBPaper00040855
    WBPaper00041562
    WBPaper00006052
    WBPaper00032031
    WBPaper00003760
    WBPaper00005370
    WBPaper00031666
    WBPaper00035315
    WBPaper00025473
  Method: Substitution_allele