WormBase Tree Display for Variation: WBVar00088446
expand all nodes | collapse all nodes | view schema
WBVar00088446 | Evidence | Paper_evidence | WBPaper00004669 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ky397 | ||||||
Other_name | CE50862:p.Gln1092Ter | |||||||
CE44901:p.Gln1109Ter | ||||||||
F59A6.1b.1:c.3274C>T | ||||||||
F59A6.1a.1:c.3325C>T | ||||||||
HGVSg | CHROMOSOME_II:g.5028087C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F33G12 | ||||
Flanking_sequences | tccaatagttcaagtcgattcttcatgctt | aaaaggattcagaacgtagaagatccttgg | ||||||
Mapping_target | F33G12 | |||||||
Type_of_mutation | Substitution | c | t | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00005266 | |||||||
WBStrain00040556 | ||||||||
Laboratory | CX | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003822 | ||||||
Transcript | F59A6.1a.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | F59A6.1a.1:c.3325C>T | |||||||
HGVSp | CE44901:p.Gln1109Ter | |||||||
cDNA_position | 3482 | |||||||
CDS_position | 3325 | |||||||
Protein_position | 1109 | |||||||
Exon_number | 9/12 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
F59A6.1b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F59A6.1b.1:c.3274C>T | |||||||
HGVSp | CE50862:p.Gln1092Ter | |||||||
cDNA_position | 3274 | |||||||
CDS_position | 3274 | |||||||
Protein_position | 1092 | |||||||
Exon_number | 8/11 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
Interactor | WBInteraction000503570 | |||||||
WBInteraction000504062 | ||||||||
Genetics | Interpolated_map_position | II | -2.5918 | |||||
Description | Phenotype (6) | |||||||
Phenotype_not_observed | WBPhenotype:0000643 | Paper_evidence | WBPaper00003760 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | nsy-1 mutants are coordinated | Paper_evidence | WBPaper00003760 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001173 | Paper_evidence | WBPaper00040855 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Adult males show appropriate cell death of the linker cell. | Paper_evidence | WBPaper00040855 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001725 | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Osmotic stress triggered upregulation of nlp-29 was not affected, based on the fluorescent ratio of control to experiment animals. | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Osmotic stress was done in liquid by incubating young adult worms in 300 mM NaCl for 6 h, with analysis occuring 24 hours later. | Paper_evidence | WBPaper00032031 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | frIs7 | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00040855 | |||||||
WBPaper00041562 | ||||||||
WBPaper00006052 | ||||||||
WBPaper00032031 | ||||||||
WBPaper00003760 | ||||||||
WBPaper00005370 | ||||||||
WBPaper00031666 | ||||||||
WBPaper00035315 | ||||||||
WBPaper00025473 | ||||||||
Method | Substitution_allele |