WormBase Tree Display for Variation: WBVar00088241

WBVar00088241 Evidence: Paper_evidence: WBPaper00005370
      WBPaper00061133
  Name: Public_name: km4
    Other_name: R03G5.2.1:c.238-425_985-53del
    HGVSg: CHROMOSOME_X:g.7817901_7819984del
  Sequence_details: SMap: S_parent: Sequence: R03G5
    Flanking_sequences: ttcattttcatccatacactagaataagtg ctatgctagatttgcgaaaaattgcaaaaa
    Mapping_target: R03G5
    Type_of_mutation: Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain (34)
    Component_of_genotype: WBGenotype00000159
    Laboratory: KU
      JN
    Status: Live
  Affects: Gene: WBGene00004758
    Transcript: R03G5.2.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: R03G5.2.1:c.238-425_985-53del
        Intron_number: 4-7/8
        Exon_number: 5-7/9
    Interactor (75)
  Genetics: Interpolated_map_position: X -1.13782
    Mapping_data: In_multi_point: 4653
  Description: Phenotype (22)
    Phenotype_not_observed: WBPhenotype:0000359 Paper_evidence: WBPaper00032255
        Curator_confirmed: WBPerson712
        Remark: Increased splicing (activation) of xbp-1 in response to Cry5B does not occur in sek-1(km4) MAPKK mutant animals. Quantitatively, at the 3 h time point the spliced form of xbp-1 is induced 1.9 fold in animals with an intact p38 MAPK pathway and depressed 1.8 fold in sek-1(km4) MAPKK mutant animals relative to untreated controls. However, sek-1 is not absolutely required for splicing of xbp-1 since, in response to tunicamycin, splicing of xbp-1 is normal in sek-1(km4) mutant animals. Paper_evidence: WBPaper00032255
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00004565 Paper_evidence: WBPaper00032255
              Curator_confirmed: WBPerson712
      WBPhenotype:0000656 Paper_evidence: WBPaper00031872
        Curator_confirmed: WBPerson712
        Remark: Rate and amplitude of endogenous EPSCs were comparable to wild type. Paper_evidence: WBPaper00031872
            Curator_confirmed: WBPerson712
      WBPhenotype:0000847 Paper_evidence: WBPaper00031872
        Curator_confirmed: WBPerson712
        Remark: The density of GFP::SNB-1 puncta in GABAergic and cholinergic axons was not significantly different from wild type. Paper_evidence: WBPaper00031872
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: nuIs152 or juIs1 Paper_evidence: WBPaper00031872
              Curator_confirmed: WBPerson712
      WBPhenotype:0001171 Paper_evidence: WBPaper00050656
        Curator_confirmed: WBPerson5092
        Remark: Fig. 2G. Mutant sek-1(km4) show similar lifespan compared to wild type Paper_evidence: WBPaper00050656
            Curator_confirmed: WBPerson5092
      WBPhenotype:0001316 Paper_evidence: WBPaper00031872
        Curator_confirmed: WBPerson712
        Remark: Muscimol activated currents were not significantly different than that observed for wild type. Paper_evidence: WBPaper00031872
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: Punc-129::GFP::SNB-1 Paper_evidence: WBPaper00031872
              Curator_confirmed: WBPerson712
      WBPhenotype:0001320 Paper_evidence: WBPaper00031872
        Curator_confirmed: WBPerson712
        Remark: The amplitudes of endogenous IPSCs were comparable to wild type. Paper_evidence: WBPaper00031872
            Curator_confirmed: WBPerson712
      WBPhenotype:0001685 Paper_evidence: WBPaper00031872
        Curator_confirmed: WBPerson712
        Remark: Post-synaptic GABAAR::GFP puncta distribution was not significantly different from wild type. Paper_evidence: WBPaper00031872
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: GFP-tagged GABAAR Paper_evidence: WBPaper00031872
              Curator_confirmed: WBPerson712
      WBPhenotype:0001725 Paper_evidence: WBPaper00032031
        Curator_confirmed: WBPerson712
        Remark: Osmotic-stress triggered upregulation of nlp-29 was not affected. Paper_evidence: WBPaper00032031
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Osmotic stress was applied in liquid by incubating young adult worms in 300 mM NaCl for 6 h, with analysis occuring 24 hours later. Paper_evidence: WBPaper00032031
              Curator_confirmed: WBPerson712
          Genotype: frIs7 Paper_evidence: WBPaper00032031
              Curator_confirmed: WBPerson712
      WBPhenotype:0002280 Paper_evidence: WBPaper00046151
        Curator_confirmed: WBPerson557
        Phenotype_assay: Treatment: Animals grown on 400 mmol/L NaCl. Paper_evidence: WBPaper00046151
              Curator_confirmed: WBPerson557
      WBPhenotype:0002423 Paper_evidence: WBPaper00049307
        Curator_confirmed: WBPerson2987
        Remark: "Multiple MAP kinase pathways were not required for Neuro-Nmnat1(gcIs30[Neuro-m-nonN-Nmnat1]) hypoxic survival." (Figure S3c) Paper_evidence: WBPaper00049307
            Curator_confirmed: WBPerson2987
        EQ_annotations: GO_term: GO:0001666 PATO:0000460 Paper_evidence: WBPaper00049307
                Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: gcIs30 [Neuro-m-nonN-Nmnat1] Paper_evidence: WBPaper00049307
              Curator_confirmed: WBPerson2987
  Reference (30)
  Remark
  Method: Deletion_allele