WormBase Tree Display for Variation: WBVar00088241
expand all nodes | collapse all nodes | view schema
WBVar00088241 | Evidence | Paper_evidence | WBPaper00005370 | ||||||
---|---|---|---|---|---|---|---|---|---|
WBPaper00061133 | |||||||||
Name | Public_name | km4 | |||||||
Other_name | R03G5.2.1:c.238-425_985-53del | ||||||||
HGVSg | CHROMOSOME_X:g.7817901_7819984del | ||||||||
Sequence_details | SMap | S_parent | Sequence | R03G5 | |||||
Flanking_sequences | ttcattttcatccatacactagaataagtg | ctatgctagatttgcgaaaaattgcaaaaa | |||||||
Mapping_target | R03G5 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (34) | |||||||||
Component_of_genotype | WBGenotype00000159 | ||||||||
Laboratory | KU | ||||||||
JN | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004758 | |||||||
Transcript | R03G5.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | R03G5.2.1:c.238-425_985-53del | ||||||||
Intron_number | 4-7/8 | ||||||||
Exon_number | 5-7/9 | ||||||||
Interactor (75) | |||||||||
Genetics | Interpolated_map_position | X | -1.13782 | ||||||
Mapping_data | In_multi_point | 4653 | |||||||
Description | Phenotype | WBPhenotype:0000016 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | % of animals paralyzed after 60 min on 1mM aldicarb was significantly higher than % of N2 animals paralyzed. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007833 | PATO:0001549 | Paper_evidence | WBPaper00031872 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000114 | Paper_evidence | WBPaper00035891 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "The p38 MAPK PMK-1 is activated by an upstream MAPKK called SEK-1 (16). Because SEK-1 might signal through MAPKs other than PMK-1, we also tested whether sek-1 was required for induction of irg-1. Of the infection response genes we tested, sek-1 mutants appeared to have similar effects on gene induction as pmk-1 mutants: a subset of genes were not fully induced by P. aeruginosa in sek-1 mutants, but most genes were still induced, including irg-1, irg-2, and irg-3 (Fig S1A). Therefore, sek-1 does not appear to be required for the pmk-1-independent-gene induction." | Paper_evidence | WBPaper00035891 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000137 | Paper_evidence | WBPaper00035315 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Endogenous T24B8.5 mRNA expression is diminished in sek-1(km4) mutants | Paper_evidence | WBPaper00035315 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035315 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000142 | Paper_evidence | WBPaper00031666 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Upregulation of pnlp-29::GFP after infection with D. coniospora or after wounding was markedly decreased from that observed for wild type. | Paper_evidence | WBPaper00031666 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were infected with D. coniospora at the L4 stage and maintained on OP50 at 20C. Animals were wounded by microinjection needle pricking of the cuticle or by femtosecond laser busts. | Paper_evidence | WBPaper00031666 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | frIs7 | Paper_evidence | WBPaper00031666 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000180 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The intensity of GFP::SNB-1 axonal fluorescence was significantly lower than that observed in wild type. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005190 | PATO:0000460 | Paper_evidence | WBPaper00031872 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | juIs1 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000420 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | % of animals paralyzed after 60 min on 200mM levamisole was significantly higher than % of N2 animals paralyzed under same conditions. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000593 | Paper_evidence | WBPaper00024218 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The sek-1(km4) mutation caused a modest sensitivity to copper ion (Figure 7C) | Paper_evidence | WBPaper00024218 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002862 | Paper_evidence | WBPaper00024218 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Strains were placed on agar plates containing cadmium ions (up to a concentration of 100 micromolar) and their development was monitored for any signs of an altered response to these toxic compounds. | Paper_evidence | WBPaper00024218 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00032209 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed arsenite-sensitive phenotypes. | Paper_evidence | WBPaper00032209 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004596 | Paper_evidence | WBPaper00032209 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Well-fed young adults of each animal were transferred to normal plates containing 5 mM sodium arsenite. The percentage of animals surviving after incubation for 1 day were scored. | Paper_evidence | WBPaper00032209 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000655 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Rates of endogenous IPSCs were significantly different from wild type. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001012 | Paper_evidence | WBPaper00038304 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Mutation in sek-1 , which encodes for a MAPK kinase essential for PMK-1 activation , also suppressed the enhanced resistance of octr-1 ( ok371 ) animals ( fig . S6 ) ." | Paper_evidence | WBPaper00038304 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00005370 | |||||||
WBPaper00035315 | |||||||||
WBPaper00041562 | |||||||||
WBPaper00045829 | |||||||||
WBPaper00061439 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2021 | |||||||||
WBPerson6515 | |||||||||
WBPerson2987 | |||||||||
WBPerson49407 | |||||||||
Remark | Animals were hyper-susceptible to PA14 killing. | Paper_evidence | WBPaper00005370 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
The sek-1(km4) mutant exhibits enhanced susceptibility to killing by PA14 relative to wildtype | Paper_evidence | WBPaper00035315 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Figure 4b | Paper_evidence | WBPaper00045829 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035315 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | GO_term | GO:0045087 | PATO:0000460 | Paper_evidence | WBPaper00045829 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Approximately 25 L4-stage worms were placed on each of three agar plates with PA14 lawns under standard slow killing (SK) assay conditions. Survival was assayed after 30 hours. | Paper_evidence | WBPaper00005370 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001073 | Paper_evidence | WBPaper00035315 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Egg laying response to food is defective | Paper_evidence | WBPaper00035315 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035315 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001173 | Paper_evidence | WBPaper00040855 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Adult males possess an inappropriately surviving linker cell in 28 percent of animals. | Paper_evidence | WBPaper00040855 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Penetrance | Incomplete | 28 percent | Paper_evidence | WBPaper00040855 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00039783 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | gcs-1 promoter induction was markedly reduced in these mutants. | Paper_evidence | WBPaper00039783 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | [gcs-1::GFP] | Paper_evidence | WBPaper00039783 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001319 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Rates of endogenous IPSCs were decreased compared to wild type. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001351 | Paper_evidence | WBPaper00032209 | |||||||
WBPaper00039783 | |||||||||
WBPaper00035583 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | Western blot analysis using an anti-phospho p38 antibody showed that animals lack the phosphorylated, activated form of p38 MAPK. | Paper_evidence | WBPaper00032209 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Cycloheximide-induced elevation in phospho-p38 levels were markedly reduced in these mutants. | Paper_evidence | WBPaper00039783 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Western blot analysis using an anti-phospho-p38 antibody that specifically recognizes the phosphorylated, activated form of p38 MAPK revealed that the sek-1(km4) mutant was defective in the phosphorylation of PMK-1 (Figure 2C, lane 1). | Paper_evidence | WBPaper00035583 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00004352 | Paper_evidence | WBPaper00039783 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001381 | Paper_evidence | WBPaper00037959 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The survival rate of animals with a mutation in sek-1 was higher than that of their wild-type counterparts. | Paper_evidence | WBPaper00037959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001621 | Paper_evidence | WBPaper00032399 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited reduced survival when exposed to oxidative-stress causing arsenite, compared to N2 animals. | Paper_evidence | WBPaper00032399 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004596 | Paper_evidence | WBPaper00032399 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were treated with 10mM Arsenite. | Paper_evidence | WBPaper00032399 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001687 | Paper_evidence | WBPaper00056945 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | sek-1(km4) animals showed positive staining of L2-L4 stages. mAb M37 stains only the L1 stage in wild type C. elegans under normal growth conditions. | Paper_evidence | WBPaper00056945 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014905 | Paper_evidence | WBPaper00056945 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001857 | Paper_evidence | WBPaper00035315 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No induction of Ptph-1::GFP expression by PA14 in the sek-1(km4) mutant background | Paper_evidence | WBPaper00035315 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035315 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002058 | Paper_evidence | WBPaper00032255 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Increased splicing (activation) of xbp-1 in response to Cry5B does not occur in sek-1(km4) MAPKK mutant animals. Quantitatively, at the 3 h time point the spliced form of xbp-1 is induced 1.9 fold in animals with an intact p38 MAPK pathway and depressed 1.8 fold in sek-1(km4) MAPKK mutant animals relative to untreated controls. However, sek-1 is not absolutely required for splicing of xbp-1 since, in response to tunicamycin, splicing of xbp-1 is normal in sek-1(km4) mutant animals. Cry5B induction of mRNA Y41CA.11 was at lower levels than in wild-type animals. | Paper_evidence | WBPaper00032255 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00005329 | Paper_evidence | WBPaper00032255 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | glp-4;sek-1 | Paper_evidence | WBPaper00032255 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002059 | Paper_evidence | WBPaper00038321 | |||||||
WBPaper00032255 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutant animals are significantly hypersensitive to Cry5B pore-forming toxins (PFTs) relative to wild type animals. | Paper_evidence | WBPaper00038321 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Comparison of sek-1(km4) and xbp-1(zc12) mutant animals on Cry5B indicates sek-1(km4) animals are more severely intoxicated than xbp-1(zc12) animals at the same dose of Cry5B. This conclusion was quantitatively confirmed by performing LC50 experiments on N2 and sek-1(km4) animals. Whereas the LC50 of xbp-1(zc12) animals on Cry5B is 5.8 fold lower than N2, the LC50 of sek-1(km4) animals on Cry5B is 170 fold lower than N2. | Paper_evidence | WBPaper00032255 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00005329 | Paper_evidence | WBPaper00032255 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | glp-4;sek-1 | Paper_evidence | WBPaper00032255 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000359 | Paper_evidence | WBPaper00032255 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Increased splicing (activation) of xbp-1 in response to Cry5B does not occur in sek-1(km4) MAPKK mutant animals. Quantitatively, at the 3 h time point the spliced form of xbp-1 is induced 1.9 fold in animals with an intact p38 MAPK pathway and depressed 1.8 fold in sek-1(km4) MAPKK mutant animals relative to untreated controls. However, sek-1 is not absolutely required for splicing of xbp-1 since, in response to tunicamycin, splicing of xbp-1 is normal in sek-1(km4) mutant animals. | Paper_evidence | WBPaper00032255 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004565 | Paper_evidence | WBPaper00032255 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000656 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Rate and amplitude of endogenous EPSCs were comparable to wild type. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000847 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The density of GFP::SNB-1 puncta in GABAergic and cholinergic axons was not significantly different from wild type. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | nuIs152 or juIs1 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00050656 | |||||||
Curator_confirmed | WBPerson5092 | ||||||||
Remark | Fig. 2G. Mutant sek-1(km4) show similar lifespan compared to wild type | Paper_evidence | WBPaper00050656 | ||||||
Curator_confirmed | WBPerson5092 | ||||||||
WBPhenotype:0001316 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Muscimol activated currents were not significantly different than that observed for wild type. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | Punc-129::GFP::SNB-1 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001320 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The amplitudes of endogenous IPSCs were comparable to wild type. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001685 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Post-synaptic GABAAR::GFP puncta distribution was not significantly different from wild type. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | GFP-tagged GABAAR | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001725 | Paper_evidence | WBPaper00032031 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Osmotic-stress triggered upregulation of nlp-29 was not affected. | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Osmotic stress was applied in liquid by incubating young adult worms in 300 mM NaCl for 6 h, with analysis occuring 24 hours later. | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | frIs7 | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002280 | Paper_evidence | WBPaper00046151 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Treatment | Animals grown on 400 mmol/L NaCl. | Paper_evidence | WBPaper00046151 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0002423 | Paper_evidence | WBPaper00049307 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Multiple MAP kinase pathways were not required for Neuro-Nmnat1(gcIs30[Neuro-m-nonN-Nmnat1]) hypoxic survival." (Figure S3c) | Paper_evidence | WBPaper00049307 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0001666 | PATO:0000460 | Paper_evidence | WBPaper00049307 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | gcIs30 [Neuro-m-nonN-Nmnat1] | Paper_evidence | WBPaper00049307 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference (30) | |||||||||
Remark | |||||||||
Method | Deletion_allele |