WormBase Tree Display for Variation: WBVar00067869
expand all nodes | collapse all nodes | view schema
| WBVar00067869 | Name | Public_name | cxTi6731 | ||
|---|---|---|---|---|---|
| Sequence_details | SMap | S_parent | Sequence | F12F3 | |
| Flanking_sequences | CTTTGAAAAATTTAGACTTACATAC | ATGTAACGCTGTATGAGAAAAGCAA | |||
| Mapping_target | F12F3 | ||||
| Type_of_mutation | Insertion | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Transposon_insertion | Tc1 | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00024963 | ||||
| Laboratory | LS | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00006436 | |||
| WBGene00001374 | |||||
| Transcript (16) | |||||
| Genetics | Interpolated_map_position | V | -0.286164 | ||
| Remark | predicted gene used to be F12F3.2a | ||||
| [20051214 db] renamed from cxP6731 | |||||
| For further information and strain requests please visit http://ums3421.univ-lyon1.fr/ | |||||
| Method | NemaGENETAG_consortium_allele |
