WormBase Tree Display for Variation: WBVar00000462
expand all nodes | collapse all nodes | view schema
WBVar00000462 | Evidence | Person_evidence | WBPerson29929 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | bn11 | |||||||
Other_name | R06A4.7.1:c.913C>T | ||||||||
CE28067:p.Arg305Ter | |||||||||
HGVSg | CHROMOSOME_II:g.14385271C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | R06A4 | |||||
Flanking_sequences | acaaaaatcgctgaaggtgctcaaaatctt | gaaatccgacgtgttacgcgtgcctcgcat | |||||||
Mapping_target | R06A4 | ||||||||
Type_of_mutation | Substitution | c | t | Person_evidence | WBPerson3695 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00034436 | ||||||||
Laboratory | SS | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003220 | |||||||
Transcript | R06A4.7.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | R06A4.7.1:c.913C>T | ||||||||
HGVSp | CE28067:p.Arg305Ter | ||||||||
cDNA_position | 916 | ||||||||
CDS_position | 913 | ||||||||
Protein_position | 305 | ||||||||
Exon_number | 3/10 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
Interactor | WBInteraction000501741 | ||||||||
WBInteraction000502626 | |||||||||
WBInteraction000502765 | |||||||||
WBInteraction000541586 | |||||||||
WBInteraction000554886 | |||||||||
WBInteraction000554890 | |||||||||
WBInteraction000557642 | |||||||||
WBInteraction000579030 | |||||||||
Genetics | Interpolated_map_position | II | 22.9532 | ||||||
Mapping_data | In_2_point | 6099 | |||||||
6101 | |||||||||
6102 | |||||||||
In_multi_point | 2167 | ||||||||
Description | Phenotype | WBPhenotype:0000154 | Paper_evidence | WBPaper00001477 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Homozygous mothers have a reduced average brood size compared to wild-type controls | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001477 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001477 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 16 C , 25 C | Paper_evidence | WBPaper00001477 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000684 | Paper_evidence | WBPaper00001477 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | Mutant progeny exhibit abnormal germline proliferation during development and fail to form mature gametes | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Few germ cells made. XO germ line less affected. | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00001477 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001477 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | unc-4(e120) | Paper_evidence | WBPaper00001477 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000711 | Paper_evidence | WBPaper00046339 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Treatment | Animals treated with IR (60 Gy) as young adults. Animals were then rescued overnight and eggs were collected from at least 15 worms for 46 hours. | Paper_evidence | WBPaper00046339 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000743 | Paper_evidence | WBPaper00048539 | |||||||
Curator_confirmed | WBPerson6615 | ||||||||
Remark | mes-2 ( bn11 ) is defective in the silencing of lir-1, lin-15b, and dpy-13 genes and modestly defective in unc-15 silencing. | Paper_evidence | WBPaper00048539 | ||||||
Curator_confirmed | WBPerson6615 | ||||||||
WBPhenotype:0001036 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Grandchildless, progeny undergo normal embryogenesis but develop into agametic adults. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001504 | Paper_evidence | WBPaper00001477 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mes phenotype is not due to abnormalities in P granule staining | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 100 | 100 | Paper_evidence | WBPaper00001477 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001477 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001477 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 16 C , 25 C | Paper_evidence | WBPaper00001477 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000052 | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001477 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001300 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Normal P granule staining. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00001477 | ||||||||
WBPaper00013902 | |||||||||
WBPaper00014214 | |||||||||
WBPaper00048539 | |||||||||
WBPaper00046339 | |||||||||
Method | Substitution_allele |