WormBase Tree Display for Strain: WBStrain00055498
expand all nodes | collapse all nodes | view schema
| WBStrain00055498 | Genotype | rpl-38(ve855[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. | ||
|---|---|---|---|---|
| Public_name | RG3355 | |||
| Contains | Gene | WBGene00001080 | ||
| WBGene00003514 | ||||
| WBGene00004452 | ||||
| WBGene00004496 | ||||
| WBGene00006789 | ||||
| Variation | WBVar00143205 | |||
| Rearrangement | sC4 | |||
| Properties | Mutagen | CRISPR_Cas9 | ||
| CGC_received | 03 May 2023 00:00:00 | |||
| Location | CGC | |||
| Remark | Homozygous sterile. Deletion of 5417 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type dim GFP+, and segregate wild-type dim GFP+, bright GFP+ sterile (ve855 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type dim GFP+.May grow better at 15C. Left flanking Sequence: CTCTCGAAAGCAGAATTAAATTCGTTTAGA; Right flanking sequence: GCTCAAGTAGATCAAATCTCTTCTCTGCTC. rpl-38 sgRNA #1: ATCCACCATTGCGATGCCAA; rpl-38 sgRNA #2: TCCTTGACTTGGATGCCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | |
| Made_by: RG KO Group | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
