WormBase Tree Display for Strain: WBStrain00049441

WBStrain00049441 Evidence: Curator_confirmed: WBPerson1983
  Status: Live
  Genotype: +/szT1[lon-2(e678) umnIs61] I; ZK899.2(ve702[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/szT1 X.
  Public_name: RG3202
  Contains: Gene: WBGene00003056
      WBGene00003514
      WBGene00004496
      WBGene00006789
    Variation: WBVar02154260
      WBVar00143398
    Rearrangement: szT1
    Transgene: WBTransgene00033227
  Properties: Outcrossed: x0
    Mutagen: CRISPR_Cas9
    CGC_received: 14 Jun 2021 00:00:00
  Location: RG
    CGC
  Remark: umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Larval lethal. Deletion of 2110 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 early larval lethal (ve702 homozygotes), Lon non-GFP mKate2+ males (szT1 hemizygotes), and dead eggs (szT1 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tttaaaaaacgtagcacgcgtattttttac ; Right flanking sequence: tggaaaataattatatttcaactttgaaca. sgRNA #1: cttcaacttctctgacacag; sgRNA #2: tttcacaatttactagtaag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. Inferred_automatically: From CGC strain data
    Made_by: RG KO Group CGC_data_submission
  Species: Caenorhabditis elegans