WormBase Tree Display for Variation: WBVar02154260
expand all nodes | collapse all nodes | view schema
| WBVar02154260 | Evidence | Curator_confirmed | WBPerson1983 | ||
|---|---|---|---|---|---|
| Name | Public_name | ve702 | |||
| HGVSg | CHROMOSOME_X:g.9450010_9452119del | ||||
| Sequence_details | SMap | S_parent | Sequence | ZK899 | |
| Flanking_sequences | tttaaaaaacgtagcacgcgtattttttac | tggaaaataattatatttcaactttgaaca | |||
| Mapping_target | ZK899 | ||||
| Type_of_mutation | Deletion | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Engineered_allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00049441 | ||||
| Production_method | CRISPR_Cas9 | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00014141 | |||
| Transcript | ZK899.2.1 | VEP_consequence | transcript_ablation | ||
| VEP_impact | HIGH | ||||
| Intron_number | 2-6/7 | ||||
| Exon_number | 1-8/8 | ||||
| Remark | Whole gene deletions made by the Rougvie, Moerman, Hutter and Sternberg labs that replace the coding sequence with a [LoxP + myo-2p::GFP::unc-54 3Prime UTR + rps-27p::neoR::unc-54 3Prime UTR + LoxP] cassette. | ||||
| Allele Description:ZK899.2(ve702[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | |||||
| sgRNA1:cttcaacttctctgacacag sgRNA2: tttcacaatttactagtaag | |||||
| Method | Engineered_allele |
