WormBase Tree Display for Strain: WBStrain00037967
expand all nodes | collapse all nodes | view schema
| WBStrain00037967 | Status | Live | ||
|---|---|---|---|---|
| Genotype | syd-1(gk802) unc-4(e120) II. | |||
| Public_name | VC10078 | |||
| Contains | Gene | WBGene00006363 | ||
| WBGene00006744 | ||||
| Variation | WBVar00146109 | |||
| WBVar00142975 | ||||
| Properties | Outcrossed | x0 | ||
| Mutagen | UV+TMP | |||
| CGC_received | 03 Jun 2009 00:00:00 | |||
| Location | CGC | |||
| Remark | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |
| F35D2.5. Unc. External left primer: TCAACGTTGTCGCTGATCTC. External right primer: CCTCAAATTCACGGAATGCT. External WT amplicon: 543 bp. This strain carries a point mutation in F35D2.5. The mutation is gk802, which is an A->T mutation at F35D2 coordinate 23221 (flanking sequences TCGACCAACTCACTAACTCTTGAGGGCCAT and TCGACAAAATCATTTGGAGACTTGAAGATG). | Inferred_automatically | From CGC strain data | ||
| Made_by: Vancouver KO Group | CGC_data_submission | |||
| Mutagen:UV/TMP | Curator_confirmed | WBPerson1983 | ||
| Species | Caenorhabditis elegans |
