WormBase Tree Display for RNAi: WBRNAi00093216
expand all nodes | collapse all nodes | view schema
| WBRNAi00093216 | Homol | Homol_homol | R74:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | ATGGCTCCCAAGCGTGCACTTCCAACAGAACAAGTTGTCGCACAACTTCTTGGCGATGATATGGGACCATCTGGGCCACGCAAAAGAGAACGACTGAATCATTTGAGTCAGGAGGAGAAAATGGATCGTCGGAAACTTAAAAATCGAGTCGCAGCCCAAAATGCTAGAGACAAAAAGAAGGAAAGATCAGCAAAGATCGAGGATGTGATGCGCGATCTGGTGGAGGAGAACCGCCGGCTCCGCGCTGAAAACGAACGTCTTCGCCGTCAAAATAAAAATCTTATGAACCAGCAGAACGAGTCCGTCATGTATATGGAAGAGAACAACGAAAACTTGATGAACAGCAATGATGCATGCATCTACCAGAACGTCGTCTACGAAGAAGAAGTCGTCGGTGAGGTTGCACCAGTTGTCGTCGTCGGAGGAGAGGATCGCCGTG | |||
| Experiment | Laboratory | BC | |||
| Date | 10 Apr 2008 00:00:00 | ||||
| Genotype | crp-1(ok685) | ||||
| Treatment | Synchronized L1 worms were transferred onto NGM plates containing various concentrations of tunicamycin (0, 2, 5 micrograms per milliliter) and seeded on RNAi plates. The developmental stage was analyzed after 24 and 48 hours at 20 degrees Celsius, and the percentages of L1 larvae and adult worms over the total population were determined and reported. | ||||
| Temperature | 20 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | R74.3 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00006959 | Inferred_automatically | RNAi_primary | ||
| Transcript | R74.3.1 | Inferred_automatically | RNAi_primary | ||
| R74.3.2 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00031857 | ||||
| Phenotype_not_observed | WBPhenotype:0000359 | Remark | xbp-1 RNAi did not affect the sensitivity of crp-1(ok685) mutants to tunicamycin | ||
| Affected_by | Molecule | WBMol:00004565 | |||
| Remark | (Figure 8D) xbp-1 RNAi | ||||
| Method | RNAi |
