WormBase Tree Display for RNAi: WBRNAi00088423
expand all nodes | collapse all nodes | view schema
| WBRNAi00088423 | Homol | Homol_homol | F22B7:RNAi | |||
|---|---|---|---|---|---|---|
| C38C10:RNAi | ||||||
| Sequence_info | DNA_text | ATGGACGTCTCTTATTACGATGGTCCCAAGGATGAAGTCGCCGAAGCAATGCTGAAAAGCGCGGTGACGGCCATGAGATTGGGACAATACGAGGATGGAAAAGGACGCTTAGAGGAGATAATGGAGTTCGGAACCTCAAATTTTCAACTACTTGGTACAATCTACATGTATTACGGAAGAGTGTGCAGGCATTTGAACCATGATGCCAAGGCCTTGGAGTTTTTCGAACATGAGTTGAACATGTTCAAATTGATCTTCAACTACCCAGAAGCATGTGATTCCACACGTCGCATCGTCGAGCAGGCACTCAAAATGGGAAAGTTCCCCAAGGCTCGACGGTTTGCTGAGGATCTCATTGATTACACCAGCAATAAGAAGAACGGAGAGAAGTATATCGGTCAAGCTCGAATTTTGTTCGCTTCCGTGTGCCTCGAAGGATGTGAAAGAGACGTCGAGAGTAATCAAGATGAGAAGAAGAAGCTTTTGTCAATATGTGCTGAACAGATTGCAGCCGTGAAATTGTTCAACGAGAATAATACGGAAGGAGCTGTGTCTGAGACCAAAATCATGTTACTTGAGGCGAAATGCTTGTCACTAGACGAAAAATACGAGGAATCGCGTCGCAAGTATCAAGAATGCATCGATTTTGCCATCAAAACAGACCAGTTTGAAGCAGTTCACATCGCCTATTACGACAAGGCTCTATATGCTGAGACAGATCTTCTTTTCTTTATTATCAGAGATCTCAGAAGTGCTCTCTTCTACGCCACGAAATTCGGAAAAGAGCGAGATGTAGTCAAATATAAGTCGAAGCTATCCGAAGAGATGCTGAGAAATGGCGAATTCCACGAAGCATATCTCTACGGATTGGAAGCGCTTGTATCGATTCGGAAGCTTGGATTGAACGAATACATTGGAGATGTGTTGCTTACAATCGCAAAGTGCCTCATTGCACTTGGAAAAAGACGCCAAGCTGCTTATTTTATCATCTTGGGGAGTGTTCTGACCATCAACCAAAACAGTTTCAAACTGTTCTACGAGCAGATCGACGTGGCGATGAATCAAGAGAGAAGCGAAACGGCAACTGATCAAGATGTATGCCTCGCAATTGATTCGTCTCCTGATCCGACATCCTCGAATGACATGATTAATAAGTTCGTCGTCGAACTGGAGCACGCAACAAATGTGGAAACCTGGGAAATGATTGTCAACGGAATCATTGACGACCAGAAGAAACCAGTGGCGATCGAAAAGAAAGAGAACGAGGAACCCGTAGACATGATGGATCTCATTTTCAGTATGAGCTCACGTATGGATGATCAAAGAACTGAACTGCCTGCTGCCAGATTCATTCCGCCTCGTCCAGTGTCATCGGCATCGAAAAAGACTACAAAGAGTCACAGAATCCTCCCTGGACTCCGTGCCAATTGGACAAAAGTGCAGTCGATGAAGTTCGATGGTCACACAATGAATAGGATCCTGAAGAGGTCGAAGAAAAGCAAATCGTCATTGGATTCTACAAATTCGATGCAGGGCGATGATACTCGAAGCGATGATGTGACAATGACGTCCAAATAG | ||||
| Experiment | Laboratory | JA | ||||
| Date | 17 Jun 2003 00:00:00 | |||||
| Delivered_by | Injection | |||||
| Inhibits | Predicted_gene | C38C10.4 | Inferred_automatically | RNAi_primary | ||
| F22B7.13 | Inferred_automatically | RNAi_primary | ||||
| Gene | WBGene00001689 | Inferred_automatically | RNAi_primary | |||
| WBGene00001688 | Inferred_automatically | RNAi_primary | ||||
| Transcript | C38C10.4.1 | Inferred_automatically | RNAi_primary | |||
| F22B7.13.1 | Inferred_automatically | RNAi_primary | ||||
| Species | Caenorhabditis elegans | |||||
| Reference | WBPaper00005945 | |||||
| Phenotype | WBPhenotype:0000050 | Remark | RNAi of gpr-1 and gpr-2 results in 100% embryonic lethality. In gpr-1/2(RNAi) embryos, as in Galpha(RNAi) embryos, the first mitotic spindle fails to rock as it elongates and is not displaced posteriorly, resulting in a symmetric, rather than an asymmetric, first cleavage. In addition, spindle morphology is symmetric, with both the anterior and posterior asters having a round morphology similar to a wild-type anterior one. Despite the fact that the first cleavage is symmetric in size as in par mutants, polarity appears to be normal; polarity markers such as PAR-2, PAR-3, PAR-6, and P granules are correctly localized in these embryos. | |||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | |||
| WBPhenotype:0000748 | Remark | RNAi of gpr-1 and gpr-2 results in 100% embryonic lethality. In gpr-1/2(RNAi) embryos, as in Galpha(RNAi) embryos, the first mitotic spindle fails to rock as it elongates and is not displaced posteriorly, resulting in a symmetric, rather than an asymmetric, first cleavage. In addition, spindle morphology is symmetric, with both the anterior and posterior asters having a round morphology similar to a wild-type anterior one. Despite the fact that the first cleavage is symmetric in size as in par mutants, polarity appears to be normal; polarity markers such as PAR-2, PAR-3, PAR-6, and P granules are correctly localized in these embryos. | ||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | |||
| Remark | paper remark: Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation. | |||||
| Method | RNAi |
