WormBase Tree Display for RNAi: WBRNAi00079059
expand all nodes | collapse all nodes | view schema
WBRNAi00079059 | Homol | Homol_homol | ZK507:RNAi | |||
---|---|---|---|---|---|---|
CHROMOSOME_III:RNAi | ||||||
T24D3:RNAi | ||||||
K04C2:RNAi | ||||||
W06F12:RNAi | ||||||
Sequence_info | DNA_text | atggcctacccttaccccgttttcaatgctgaaaatgtctttgacaatacccagcaacaagttggattctatgattattcaactccattcaatggtacatactcctttactactgactattcttattataataactactatgactatgtcaatacttatgcttcttattatccaactgcaatggattcttcatctttaaatatttcatcaactactggaagtcctaattcttcacatttcaccacgtttactcatttttccactccatctacatctccatctacctctactcaaagttcaactacaccgagcaattctgataataagaagtcatttcaatgctcaaattgttcagtaactgaaacaattcgttggaggaatattcgatcaaaggaaggaattcaatgtaatgcttgtttcatttatcaacggaaatataataagactcgtccagtcactgccgttaacaaatatcaaaaaagaaaattaaaggtacaggaaacgaatggtgtagattcattttaa | ||||
PCR_product | sjj_F02A9.6 | |||||
sjj_W06F12.1 | ||||||
Experiment | Laboratory | JR | ||||
Date | 25 Jan 2001 00:00:00 | |||||
Delivered_by | Injection | |||||
Inhibits | Predicted_gene | W06F12.1d | Inferred_automatically | RNAi_primary | ||
W06F12.1c | Inferred_automatically | RNAi_primary | ||||
F02A9.6 | Inferred_automatically | RNAi_primary | ||||
T24D3.1 | Inferred_automatically | RNAi_primary | ||||
W06F12.1a | Inferred_automatically | RNAi_primary | ||||
W06F12.1e | Inferred_automatically | RNAi_primary | ||||
K04C2.6 | Inferred_automatically | RNAi_primary | ||||
W06F12.1b | Inferred_automatically | RNAi_primary | ||||
Gene | WBGene00003180 | Inferred_automatically | RNAi_primary | |||
WBGene00003181 | Inferred_automatically | RNAi_primary | ||||
WBGene00001609 | Inferred_automatically | RNAi_primary | ||||
WBGene00003048 | Inferred_automatically | RNAi_primary | ||||
Transcript | W06F12.1a.1 | Inferred_automatically | RNAi_primary | |||
F02A9.6.1 | Inferred_automatically | RNAi_primary | ||||
T24D3.1.1 | Inferred_automatically | RNAi_primary | ||||
W06F12.1d.1 | Inferred_automatically | RNAi_primary | ||||
W06F12.1d.3 | Inferred_automatically | RNAi_primary | ||||
K04C2.6.1 | Inferred_automatically | RNAi_primary | ||||
W06F12.1b.1 | Inferred_automatically | RNAi_primary | ||||
W06F12.1c.1 | Inferred_automatically | RNAi_primary | ||||
W06F12.1e.1 | Inferred_automatically | RNAi_primary | ||||
W06F12.1d.2 | Inferred_automatically | RNAi_primary | ||||
Species | Caenorhabditis elegans | |||||
Reference | WBPaper00004636 | |||||
Phenotype | WBPhenotype:0001375 | Remark | Loss of ceh-22::GFP expression (pharyngeal marker) | |||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | |||
WBPhenotype:0001637 | Penetrance | Complete | ||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | |||
WBPhenotype:0001646 | Remark | Synthetic phenotype: glp-1/lit-1 double RNAi generates very low penetrance of the no_pharynx phenotype and med-1/2 RNAi does not generate the no_pharynx phenotype. RNAi against glp-1/lit-1/med-1/2 produces a moderately penetrant no_pharynx phenotype. | ||||
Penetrance | Incomplete | |||||
Range | 22 | |||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | |||
Remark | Exact sequence used for glp-1 and lit-1 RNAi not stated by authors, Ahringer laboratory clone used for curation. Exact sequence used for med-1/2 RNAi not stated by authors, spliced coding region sequence of med-1 gene used for curation. | |||||
Method | RNAi |