WormBase Tree Display for RNAi: WBRNAi00078448
expand all nodes | collapse all nodes | view schema
| WBRNAi00078448 | Homol | Homol_homol | C27B7:RNAi | ||
|---|---|---|---|---|---|
| ZC513:RNAi | |||||
| F32A11:RNAi | |||||
| Sequence_info | DNA_text | agtggtgtattctcatcgggagttcatgcttcatcacctagtcatagtcaaggatcatcatcgcagagtgggccaccgagtcctactactcagttgaactcgttgctttttgaaactgctaacctgattgcggtgaatgagcaattgagaaaggaaattgcagaaaacaagcaaatccagacgaaccagatgcgagcactcagatactcctcaaatccagtcgatcagccatttgtagcgaattcgatatcaccacatcacgggtttccacaacgcccccctcgcggcgaacggcggatgcaaaagcccgaatcttacaagacgg | |||
| agccacttttatcatagtttctcaattttaattttcttttttaagggctcgtacagagtcgagtgttgaaccatcgcatcccgatatgatggagactgttccggaagaacagcaaaaaccgatttctcatatcgacgatttgctttccgagaccgctaacctgatggctgtcaaggagcagcttctcaaggagattgctgagtaattctataggataaatggactgtttcttaaattttatcttctcagaaacgagcatattcattcgatgcaaatgagagctcttcaaaatcttccacaggaagctattctcccactgcaatatcatgctgatccaagacgccgtcaccgaatgcaaaaaccggaatcgtacaagactgtcatatgtcaggcttggttggagtcgaagacatgtg | |||||
| cgtccaacattgtaagaatgaagcaaacaaattatgttaattccaatttttagcgtcgagccgctgcagaacaataagtataaaacgaaactctgtgacaaatatacgactacaggactctgcccatacgggaaacggtgccttttcattcatcccgatcatggaccaaacgcatacattcgcgctgataaacttcttgaagtcagaagaaaacatgtatttttgctcactgtaaacattttcaggtttctcaacgccatgcattggctgacattcgtgatcaaatggagcagcacatcatgactaatggtcgcattgcagctcccccgctttctgccattcagcatcctttagaaa | |||||
| Experiment | Date | 17 Jun 2002 00:00:00 | |||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F32A11.6 | Inferred_automatically | RNAi_primary | |
| C09G9.6 | Inferred_automatically | RNAi_primary | |||
| ZC513.6 | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00003864 | Inferred_automatically | RNAi_primary | ||
| WBGene00003388 | Inferred_automatically | RNAi_primary | |||
| WBGene00003865 | Inferred_automatically | RNAi_primary | |||
| Transcript | C09G9.6.1 | Inferred_automatically | RNAi_primary | ||
| F32A11.6.1 | Inferred_automatically | RNAi_primary | |||
| ZC513.6.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000050751 | ||||
| Reference | WBPaper00005454 | ||||
| Phenotype | WBPhenotype:0000105 | Remark | More than 85 percent reduction in the number of laid eggs compared to the control with all three RNAis. Individually, these RNAis do not affect the number of eggs laid and oma-1 and oma-2 together only give a 60 percent reduction, therefore moe-3 has an effect on this process. | ||
| WBPhenotype:0000154 | Remark | More than 85 percent reduction in the number of laid eggs compared to the control with all three RNAis. Individually, these RNAis do not affect the number of eggs laid and oma-1 and oma-2 together only give a 60 percent reduction, therefore moe-3 has an effect on this process. | |||
| Method | RNAi |
