WormBase Tree Display for RNAi: WBRNAi00077402
expand all nodes | collapse all nodes | view schema
| WBRNAi00077402 | Homol | Homol_homol | F46C3:RNAi | ||
|---|---|---|---|---|---|
| C41C4:RNAi | |||||
| Sequence_info | DNA_text | atgagagcaacatttcatctattcacatttatttttttgctgctcttctcctctgtaatttgtattagcacacctggcttccggaatgtgagtttctgtactacaaaaaacaaaatttcattatttttcgttgttcaggatcacgaatcaataggagacgacgaagagaaaacatcttcaactatacttgtttcgacaattgatggacgtttgagagctttggattcagagacgggagaaataaaatggacattgcaagaaggtttaattttttaaatttaagttttgaaaattcacattactttgtttcagagcctgttttacgatctccatctgctgtcaaacagggatttacatttcttccgaatccgctcgatggatcactttatgttttgaaaaacagttctttgaaaaaacttccattcaatattccacaattagttcatgcatcaccttgcaaaggaaatgatggaattttatacgcaggaagtaagaaagatgtttggtttggaattgatcca | |||
| atgagtgtgtattatatagttttagctgggttcttgctcttcatggccttggtaccattcaacgctggccaacagtacatcgatgatgacatagaagttgtatcatcttgtcaagtgagttttgcatatatttttgcttgaacctttatatacatataattgaatttacagaatggttatgtacaaaatgcgggttgtgatcagaatagtcaagtgaacattattatcaccgctactctggatggagtcgtcactgcactggatggagaaacgggtgaaatgatttggagatacgaggatgcaccacttttaagaggaacgctgagcacatctgacgtaagaaatttcaatggttgatttcttttcaagcacatgaaatttgaaaaagaaaaaaaacagcgatgcttatttgatattctaaactttggagcaaaattttgttttttgaagttttgtaaaatcgcctagttaattattccaatacggaaagtaatgattgtctgttttagccgattgacattggagg | |||||
| Experiment | Date | 03 Dec 2001 00:00:00 | |||
| Strain | WBStrain00000001 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F46C3.1 | Inferred_automatically | RNAi_primary | |
| C41C4.4a | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00002147 | Inferred_automatically | RNAi_primary | ||
| WBGene00003970 | Inferred_automatically | RNAi_primary | |||
| Transcript | F46C3.1.1 | Inferred_automatically | RNAi_primary | ||
| C41C4.4a.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000009184 | ||||
| Reference | WBPaper00005044 | ||||
| Phenotype | WBPhenotype:0000032 | ||||
| WBPhenotype:0000082 | |||||
| WBPhenotype:0000646 | |||||
| WBPhenotype:0000708 | Remark | Intestinal cells under go necrotic cell death and intestine degrades in worms 5 or 6 days post egg lay. | |||
| WBPhenotype:0000709 | Remark | The connection between the intestine and pharynx narrowed, so bacteria could not pass through in worms 4 days post egg lay. | |||
| WBPhenotype:0000848 | Remark | L2 Arrest | |||
| WBPhenotype:0001428 | |||||
| Method | RNAi |
