WormBase Tree Display for Sequence: R11A5

R11A5 DNA: R11A5 26671
  SMap: S_child: Gene_child: WBGene00220041 8322 8157
        WBGene00011230 7634 5973
        WBGene00011231 11786 10746
        WBGene00011234 16135 15794
        WBGene00000163 1967 6070
        WBGene00011235 23771 20309
        WBGene00011232 14353 20317
      CDS_child (247)
      Transcript (12)
      Nongenomic: yk293g1 14593 20228
      PCR_product (32)
      Allele (268)
      Oligo_set: Aff_F30F8.8 699 1715
        Aff_R11A5.1A 5189 5963
        Aff_R11A5.2 7253 6339
        Aff_R11A5.3 11740 11130
        Aff_R11A5.4 19453 20100
        Aff_R11A5.5 16772 16431
        Aff_R11A5.6 16135 15794
        Aff_R11A5.7 21248 20482
      Feature_object (479)
      Feature_data: R11A5:Polysome 1 26671
        R11A5:TranscriptionallyActiveRegion 1 26671
        R11A5:ChIPSeqTF 1 26671
        R11A5:TRF 1 26671
        R11A5:Dust 1 26671
        R11A5:inverted 1 26671
      Homol_data (20)
  Structure: From: Source: CHROMOSOME_I
    Overlap_right: F55D12 26568
    Overlap_left: F30F8
    Clone_left_end: R11A5 1
      F55D12 26568
    Clone_right_end: F30F8 104
  DB_info: Database: EMBL NDB_AC Z83122
        NDB_SV Z83122.2
    DB_remark: [121025] Sequence correction: SNP 0 bases @ 17231
      [121025] Sequence correction: SNP 0 bases @ 17232
    Keyword: HTG
    EMBL_dump_info: EMBL_dump_method: worm_EMBL-dump
  Origin: From_author: McMurray AA
    From_laboratory: HX
    Date_directory: 970224
    Species: Caenorhabditis elegans
    Strain: WBStrain00000001
  Visible: Clone: R11A5
  Properties: Genomic_canonical
    Checksum: MD5: 39890749de2e2b6e8a44cc3a00fa5d30
    Status: Finished: 24 Feb 1997 00:00:00
      Submitted: 27 Nov 1996 00:00:00
      Annotated: 08 May 1997 00:00:00
  Map: Sequence-I Ends: Left: 3702
        Right: 3725
  Interpolated_map_position: I 2.38284
  Assembly_tags: Finished Left 1 4 R11A5
    Clone right end 101 104 F30F8
    annotation 16381 16395 tandem repeat across bases 16460 - 16850. The repeat element is TCGTGGTGAGACCCA (15-mer).
      16744 16778 tandem repeat across bases 16860 - 17070. A typical repeat sequence is TTTTGGCGGGAAATTTAAATTTTCTGTGAAAAATA (a 35-mer).
      17008 17048 tandem repeat across bases 17130 - 17730. A typical repeat element is TCTTCTGGAAATTTCGAAAAAATTCTCGAATGTTCCAGAAC (41-mer). Restriction digests indicate that the true extent of this repeat is ca 1.7kb longer than shown here.
      16502 16516 tandem repeat across bases 16460 - 16850. The repeat element is TCGTGGTGAGACCCA (15-mer).
      16865 16899 tandem repeat across bases 16860 - 17070. A typical repeat sequence is TTTTGGCGGGAAATTTAAATTTTCTGTGAAAAATA (a 35-mer).
      17129 17169 tandem repeat across bases 17130 - 17730. A typical repeat element is TCTTCTGGAAATTTCGAAAAAATTCTCGAATGTTCCAGAAC (41-mer). Restriction digests indicate that the true extent of this repeat is ca 1.7kb longer than shown here.
    Finished Right 26668 26671 R11A5
    Clone left end 1 6 R11A5
      26568 26571 F55D12
  Method: Genomic_canonical