WormBase Tree Display for Sequence: R11A5
expand all nodes | collapse all nodes | view schema
R11A5 | DNA | R11A5 | 26671 | |||
---|---|---|---|---|---|---|
SMap | S_child | Gene_child | WBGene00220041 | 8322 | 8157 | |
WBGene00011230 | 7634 | 5973 | ||||
WBGene00011231 | 11786 | 10746 | ||||
WBGene00011234 | 16135 | 15794 | ||||
WBGene00000163 | 1967 | 6070 | ||||
WBGene00011235 | 23771 | 20309 | ||||
WBGene00011232 | 14353 | 20317 | ||||
CDS_child (247) | ||||||
Transcript (12) | ||||||
Nongenomic | yk293g1 | 14593 | 20228 | |||
PCR_product (32) | ||||||
Allele (268) | ||||||
Oligo_set | Aff_F30F8.8 | 699 | 1715 | |||
Aff_R11A5.1A | 5189 | 5963 | ||||
Aff_R11A5.2 | 7253 | 6339 | ||||
Aff_R11A5.3 | 11740 | 11130 | ||||
Aff_R11A5.4 | 19453 | 20100 | ||||
Aff_R11A5.5 | 16772 | 16431 | ||||
Aff_R11A5.6 | 16135 | 15794 | ||||
Aff_R11A5.7 | 21248 | 20482 | ||||
Feature_object (479) | ||||||
Feature_data | R11A5:Polysome | 1 | 26671 | |||
R11A5:TranscriptionallyActiveRegion | 1 | 26671 | ||||
R11A5:ChIPSeqTF | 1 | 26671 | ||||
R11A5:TRF | 1 | 26671 | ||||
R11A5:Dust | 1 | 26671 | ||||
R11A5:inverted | 1 | 26671 | ||||
Homol_data | R11A5:RNAi | 1 | 26671 | |||
R11A5:SAGE | 1 | 26671 | ||||
R11A5:Mass-spec | 1 | 26671 | ||||
R11A5:Expr | 1 | 26671 | ||||
R11A5:TEC_RED | 1 | 26671 | ||||
R11A5:wublastx_brenneri | 1 | 26671 | ||||
R11A5:wublastx_briggsae | 1 | 26671 | ||||
R11A5:wublastx_brugia | 1 | 26671 | ||||
R11A5:wublastx_fly | 1 | 26671 | ||||
R11A5:wublastx_human | 1 | 26671 | ||||
R11A5:wublastx_japonica | 1 | 26671 | ||||
R11A5:wublastx_ovolvulus | 1 | 26671 | ||||
R11A5:wublastx_pristionchus | 1 | 26671 | ||||
R11A5:wublastx_remanei | 1 | 26671 | ||||
R11A5:wublastx_slimSwissProt | 1 | 26671 | ||||
R11A5:wublastx_sratti | 1 | 26671 | ||||
R11A5:wublastx_tmuris | 1 | 26671 | ||||
R11A5:wublastx_worm | 1 | 26671 | ||||
R11A5:wublastx_yeast | 1 | 26671 | ||||
R11A5:RepeatMasker | 1 | 26671 | ||||
Structure | From | Source | CHROMOSOME_I | |||
Overlap_right | F55D12 | 26568 | ||||
Overlap_left | F30F8 | |||||
Clone_left_end | R11A5 | 1 | ||||
F55D12 | 26568 | |||||
Clone_right_end | F30F8 | 104 | ||||
DB_info | Database | EMBL | NDB_AC | Z83122 | ||
NDB_SV | Z83122.2 | |||||
DB_remark | [121025] Sequence correction: SNP 0 bases @ 17231 | |||||
[121025] Sequence correction: SNP 0 bases @ 17232 | ||||||
Keyword | HTG | |||||
EMBL_dump_info | EMBL_dump_method | worm_EMBL-dump | ||||
Origin | From_author | McMurray AA | ||||
From_laboratory | HX | |||||
Date_directory | 970224 | |||||
Species | Caenorhabditis elegans | |||||
Strain | WBStrain00000001 | |||||
Visible | Clone | R11A5 | ||||
Properties | Genomic_canonical | |||||
Checksum | MD5 | 39890749de2e2b6e8a44cc3a00fa5d30 | ||||
Status | Finished | 24 Feb 1997 00:00:00 | ||||
Submitted | 27 Nov 1996 00:00:00 | |||||
Annotated | 08 May 1997 00:00:00 | |||||
Map | Sequence-I | Ends | Left | 3702 | ||
Right | 3725 | |||||
Interpolated_map_position | I | 2.38284 | ||||
Assembly_tags | Finished Left | 1 | 4 | R11A5 | ||
Clone right end | 101 | 104 | F30F8 | |||
annotation | 16381 | 16395 | tandem repeat across bases 16460 - 16850. The repeat element is TCGTGGTGAGACCCA (15-mer). | |||
16744 | 16778 | tandem repeat across bases 16860 - 17070. A typical repeat sequence is TTTTGGCGGGAAATTTAAATTTTCTGTGAAAAATA (a 35-mer). | ||||
17008 | 17048 | tandem repeat across bases 17130 - 17730. A typical repeat element is TCTTCTGGAAATTTCGAAAAAATTCTCGAATGTTCCAGAAC (41-mer). Restriction digests indicate that the true extent of this repeat is ca 1.7kb longer than shown here. | ||||
16502 | 16516 | tandem repeat across bases 16460 - 16850. The repeat element is TCGTGGTGAGACCCA (15-mer). | ||||
16865 | 16899 | tandem repeat across bases 16860 - 17070. A typical repeat sequence is TTTTGGCGGGAAATTTAAATTTTCTGTGAAAAATA (a 35-mer). | ||||
17129 | 17169 | tandem repeat across bases 17130 - 17730. A typical repeat element is TCTTCTGGAAATTTCGAAAAAATTCTCGAATGTTCCAGAAC (41-mer). Restriction digests indicate that the true extent of this repeat is ca 1.7kb longer than shown here. | ||||
Finished Right | 26668 | 26671 | R11A5 | |||
Clone left end | 1 | 6 | R11A5 | |||
26568 | 26571 | F55D12 | ||||
Method | Genomic_canonical |