WormBase Tree Display for Expr_pattern: Expr7256
expand all nodes | collapse all nodes | view schema
Expr7256 | Expression_of | Gene | WBGene00014083 | |
---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00014083 | |||
Homol | Homol_homol | ZK795:Expr | ||
Expression_data | Life_stage | WBls:0000041 | ||
Anatomy_term | WBbt:0005319 | Certain | ||
WBbt:0005735 | Certain | |||
WBbt:0005747 | Certain | |||
WBbt:0005812 | Certain | |||
WBbt:0006751 | Certain | |||
Type | Reporter_gene | [ZK795.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAGCCAAGAACAGTAAGAAACCA] 3' and primer B 5' [CGGCGAATGATTCTGAAAT] 3'. | ||
Pattern | Adult Expression: Reproductive System; spermatheca; excretory cell; Nervous System; head neurons; | |||
Remark | Also expressed in (comments from author) : incomplete. Will be updated. | |||
Strain: BC10285 | ||||
Reference | WBPaper00006525 | |||
Transgene | WBTransgene00002173 |