WormBase Tree Display for Expr_pattern: Expr7256
expand all nodes | collapse all nodes | view schema
Expr7256 | Expression_of | Gene | WBGene00014083 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00014083 | ||
Homol | Homol_homol | ZK795:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [ZK795.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAGCCAAGAACAGTAAGAAACCA] 3' and primer B 5' [CGGCGAATGATTCTGAAAT] 3'. | |
Pattern | Adult Expression: Reproductive System; spermatheca; excretory cell; Nervous System; head neurons; | ||
Remark | Also expressed in (comments from author) : incomplete. Will be updated. | ||
Strain: BC10285 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002173 |