WormBase Tree Display for Expr_pattern: Expr7195
expand all nodes | collapse all nodes | view schema
| Expr7195 | Expression_of | Gene | WBGene00001887 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00001887 | ||
| Expression_data | Life_stage | WBls:0000023 | |
| Anatomy_term | WBbt:0005735 | ||
| WBbt:0006751 | |||
| Type | Reporter_gene | [his-13::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAATACCTTCCTTCAGCATGT] 3' and primer B 5' [GCTTAGTACGAGCGATGATGC] 3'. | |
| Pattern | Larval Expression: Nervous System; head neurons; | ||
| Picture | WBPicture0000007103 | ||
| Remark | Also expressed in (comments from author) : Note: primers are not unique and produce 3 products. | ||
| Strain: BC15299 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00003925 |
