WormBase Tree Display for Expr_pattern: Expr7002
expand all nodes | collapse all nodes | view schema
Expr7002 | Expression_of | Gene | WBGene00012980 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00012980 | ||
Homol | Homol_homol | Y48B6A:Expr | |
Expression_data | Life_stage (2) | ||
Anatomy_term | WBbt:0003681 | ||
WBbt:0005300 | |||
WBbt:0005735 | |||
WBbt:0005813 | |||
Type | Reporter_gene | [Y48B6A.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACCAAACCTCTTCGTCCAT] 3' and primer B 5' [AATTCAGGACTCGCGATTTT] 3'. | |
Pattern | Adult Expression: pharynx; body wall muscle; Nervous System; ventral nerve cord; unidentified cells; | ||
Larval Expression: pharynx; body wall muscle; unidentified cells; | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC10665 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002356 |