WormBase Tree Display for Expr_pattern: Expr6980
expand all nodes | collapse all nodes | view schema
| Expr6980 | Expression_of | Gene | WBGene00021573 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00021573 | ||
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0005735 | ||
| WBbt:0005767 | |||
| WBbt:0005772 | |||
| WBbt:0005799 | |||
| WBbt:0006751 | |||
| Type | Reporter_gene | [Y45G12C.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTTAATAGTCACCTGCAAACCG] 3' and primer B 5' [TTTAGTTAGAATGGCAGGTGGAA] 3'. | |
| Pattern | Adult Expression: intestine; | ||
| Larval Expression: pharyngeal-intestinal valve; intestine; rectal gland cells; Nervous System; head neurons; | |||
| Picture | WBPicture0000006824 | ||
| Remark | Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. | ||
| Strain: BC15488 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00003987 |
