WormBase Tree Display for Expr_pattern: Expr6980
expand all nodes | collapse all nodes | view schema
Expr6980 | Expression_of | Gene | WBGene00021573 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00021573 | ||
Expression_data | Life_stage (2) | ||
Anatomy_term | WBbt:0005735 | ||
WBbt:0005767 | |||
WBbt:0005772 | |||
WBbt:0005799 | |||
WBbt:0006751 | |||
Type | Reporter_gene | [Y45G12C.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTTAATAGTCACCTGCAAACCG] 3' and primer B 5' [TTTAGTTAGAATGGCAGGTGGAA] 3'. | |
Pattern | Adult Expression: intestine; | ||
Larval Expression: pharyngeal-intestinal valve; intestine; rectal gland cells; Nervous System; head neurons; | |||
Picture | WBPicture0000006824 | ||
Remark | Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. | ||
Strain: BC15488 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003987 |