WormBase Tree Display for Expr_pattern: Expr6954
expand all nodes | collapse all nodes | view schema
Expr6954 | Expression_of | Gene | WBGene00000022 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00000022 | ||
Homol | Homol_homol | T22H9:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (12) | |||
Type | Reporter_gene | [abt-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTGCTTTGGAATTTCAGGT] 3' and primer B 5' [CAATGCACCGATTCTGAAAA] 3'. | |
Pattern | Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; hypodermis; Nervous System; head neurons; amphid socket cells; pharyngeal neurons; unidentified cells in head; unidentified cells in tail ; | ||
Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; hypodermis; Nervous System; head neurons; amphid socket cells; pharyngeal neurons; unidentified cells in head; unidentified cells in tail ; | |||
Picture | WBPicture0000006798 | ||
WBPicture0000006799 | |||
WBPicture0000006800 | |||
WBPicture0000006801 | |||
WBPicture0000006802 | |||
Remark | Also expressed in (comments from author) : NSM neurons in the head (Hall Lab, 2005). | ||
Strain: BC11521 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004268 |