WormBase Tree Display for Expr_pattern: Expr6954
expand all nodes | collapse all nodes | view schema
Expr6954 | Expression_of | Gene | WBGene00000022 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00000022 | ||||
Homol | Homol_homol | T22H9:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0003929 | |||||
WBbt:0003931 | |||||
WBbt:0005439 | |||||
WBbt:0005733 | |||||
WBbt:0005735 | |||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005741 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005767 | |||||
WBbt:0005772 | |||||
WBbt:0005799 | |||||
WBbt:0006751 | |||||
Type | Reporter_gene | [abt-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTGCTTTGGAATTTCAGGT] 3' and primer B 5' [CAATGCACCGATTCTGAAAA] 3'. | |||
Pattern | Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; hypodermis; Nervous System; head neurons; amphid socket cells; pharyngeal neurons; unidentified cells in head; unidentified cells in tail ; | ||||
Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; hypodermis; Nervous System; head neurons; amphid socket cells; pharyngeal neurons; unidentified cells in head; unidentified cells in tail ; | |||||
Picture | WBPicture0000006798 | ||||
WBPicture0000006799 | |||||
WBPicture0000006800 | |||||
WBPicture0000006801 | |||||
WBPicture0000006802 | |||||
Remark | Also expressed in (comments from author) : NSM neurons in the head (Hall Lab, 2005). | ||||
Strain: BC11521 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00004268 |