Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6933

expand all nodes | collapse all nodes | view schema

Name Class

Expr6933Expression_ofGeneWBGene00021369
Reflects_endogenous_expression_ofWBGene00021369
HomolHomol_homolY37E11AR:Expr
Expression_dataLife_stage (2)
Anatomy_term (18)
TypeReporter_gene[Y37E11AR.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGGTGAGCACAATTTCCC] 3' and primer B 5' [TTACTGATCAGCGAAGGCAGT] 3'.
PatternAdult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; body wall muscle; excretory cell; Nervous System; nerve ring; head neurons; pharyngeal neurons; tail neurons; unidentified cells in tail ;
Larval Expression: pharynx; intestine; Reproductive System; distal tip cell; developing vulva; developing uterus; body wall muscle; excretory cell; Nervous System; nerve ring; head neurons; pharyngeal neurons; tail neurons; unidentified cells in tail ;
RemarkStrain: BC13878
ReferenceWBPaper00006525
TransgeneWBTransgene00003314