WormBase Tree Display for Expr_pattern: Expr6850
expand all nodes | collapse all nodes | view schema
Expr6850 | Expression_of | Gene | WBGene00012321 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00012321 | ||
Homol | Homol_homol | W07A8:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0005735 | ||
WBbt:0005772 | |||
WBbt:0006751 | |||
WBbt:0006759 | |||
Type | Reporter_gene | [srxa-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCCAATTTTTGGATTTTTCG] 3' and primer B 5' [TGAGAAAATCGACCTGGAGAA] 3'. | |
Pattern | Adult Expression: Nervous System; head neurons; tail neurons; | ||
Larval Expression: intestine; Nervous System; head neurons; tail neurons; | |||
Remark | Also expressed in (comments from author) : ASH + ASI amphid neurons; PHB phasmid neuron. Very strong and consistent expression in PHB. Weaker and more inconsistently in ASH and very weak in ASI. (Sengupta Lab 2005) | ||
Strain: BC14847 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003743 |